ID: 1052930287

View in Genome Browser
Species Human (GRCh38)
Location 9:34050082-34050104
Sequence TCGACCGAATATGCAGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052930287_1052930297 23 Left 1052930287 9:34050082-34050104 CCCGAAGCTGCATATTCGGTCGA No data
Right 1052930297 9:34050128-34050150 AGAGGACAAGTCAAGGATATAGG No data
1052930287_1052930296 16 Left 1052930287 9:34050082-34050104 CCCGAAGCTGCATATTCGGTCGA No data
Right 1052930296 9:34050121-34050143 CCATAGAAGAGGACAAGTCAAGG No data
1052930287_1052930291 5 Left 1052930287 9:34050082-34050104 CCCGAAGCTGCATATTCGGTCGA No data
Right 1052930291 9:34050110-34050132 AGGAGCATCCCCCATAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052930287 Original CRISPR TCGACCGAATATGCAGCTTC GGG (reversed) Intergenic
No off target data available for this crispr