ID: 1052932183

View in Genome Browser
Species Human (GRCh38)
Location 9:34064782-34064804
Sequence CTTTATGTCCAGTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052932183_1052932188 -7 Left 1052932183 9:34064782-34064804 CCTCCTCCCCACTGGACATAAAG No data
Right 1052932188 9:34064798-34064820 CATAAAGCTTCTTGAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052932183 Original CRISPR CTTTATGTCCAGTGGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr