ID: 1052936803

View in Genome Browser
Species Human (GRCh38)
Location 9:34099982-34100004
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936803_1052936806 -5 Left 1052936803 9:34099982-34100004 CCCCTCTAGAGCAGTGGTACTTA No data
Right 1052936806 9:34100000-34100022 ACTTAACCTTTTTTGAGCCTTGG No data
1052936803_1052936814 29 Left 1052936803 9:34099982-34100004 CCCCTCTAGAGCAGTGGTACTTA No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG 0: 6
1: 62
2: 546
3: 4378
4: 34677
1052936803_1052936813 28 Left 1052936803 9:34099982-34100004 CCCCTCTAGAGCAGTGGTACTTA No data
Right 1052936813 9:34100033-34100055 GTCTCTCTTTTTTTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936803 Original CRISPR TAAGTACCACTGCTCTAGAG GGG (reversed) Intronic