ID: 1052936804

View in Genome Browser
Species Human (GRCh38)
Location 9:34099983-34100005
Sequence TTAAGTACCACTGCTCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936804_1052936813 27 Left 1052936804 9:34099983-34100005 CCCTCTAGAGCAGTGGTACTTAA No data
Right 1052936813 9:34100033-34100055 GTCTCTCTTTTTTTAGAGACAGG No data
1052936804_1052936806 -6 Left 1052936804 9:34099983-34100005 CCCTCTAGAGCAGTGGTACTTAA No data
Right 1052936806 9:34100000-34100022 ACTTAACCTTTTTTGAGCCTTGG No data
1052936804_1052936814 28 Left 1052936804 9:34099983-34100005 CCCTCTAGAGCAGTGGTACTTAA No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936804 Original CRISPR TTAAGTACCACTGCTCTAGA GGG (reversed) Intronic