ID: 1052936807

View in Genome Browser
Species Human (GRCh38)
Location 9:34100006-34100028
Sequence GGGGGTCCAAGGCTCAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936807_1052936816 17 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936807_1052936813 4 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936813 9:34100033-34100055 GTCTCTCTTTTTTTAGAGACAGG No data
1052936807_1052936815 16 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936815 9:34100045-34100067 TTAGAGACAGGGTCTCACTTTGG No data
1052936807_1052936817 18 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936817 9:34100047-34100069 AGAGACAGGGTCTCACTTTGGGG No data
1052936807_1052936818 24 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936818 9:34100053-34100075 AGGGTCTCACTTTGGGGCCCAGG No data
1052936807_1052936814 5 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936807_1052936819 25 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936807 Original CRISPR GGGGGTCCAAGGCTCAAAAA AGG (reversed) Intronic