ID: 1052936808

View in Genome Browser
Species Human (GRCh38)
Location 9:34100017-34100039
Sequence GAGAGACATAAGGGGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936808_1052936817 7 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936817 9:34100047-34100069 AGAGACAGGGTCTCACTTTGGGG No data
1052936808_1052936821 23 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936821 9:34100063-34100085 TTTGGGGCCCAGGGTAGACAGGG No data
1052936808_1052936818 13 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936818 9:34100053-34100075 AGGGTCTCACTTTGGGGCCCAGG No data
1052936808_1052936820 22 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936820 9:34100062-34100084 CTTTGGGGCCCAGGGTAGACAGG No data
1052936808_1052936814 -6 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936808_1052936813 -7 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936813 9:34100033-34100055 GTCTCTCTTTTTTTAGAGACAGG No data
1052936808_1052936816 6 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936808_1052936815 5 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936815 9:34100045-34100067 TTAGAGACAGGGTCTCACTTTGG No data
1052936808_1052936819 14 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936808 Original CRISPR GAGAGACATAAGGGGGTCCA AGG (reversed) Intronic