ID: 1052936810

View in Genome Browser
Species Human (GRCh38)
Location 9:34100025-34100047
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936810_1052936820 14 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936820 9:34100062-34100084 CTTTGGGGCCCAGGGTAGACAGG No data
1052936810_1052936817 -1 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936817 9:34100047-34100069 AGAGACAGGGTCTCACTTTGGGG No data
1052936810_1052936824 24 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936824 9:34100072-34100094 CAGGGTAGACAGGGCAATAGTGG No data
1052936810_1052936821 15 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936821 9:34100063-34100085 TTTGGGGCCCAGGGTAGACAGGG No data
1052936810_1052936819 6 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936810_1052936815 -3 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936815 9:34100045-34100067 TTAGAGACAGGGTCTCACTTTGG No data
1052936810_1052936818 5 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936818 9:34100053-34100075 AGGGTCTCACTTTGGGGCCCAGG No data
1052936810_1052936816 -2 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936810 Original CRISPR TAAAAAAAGAGAGACATAAG GGG (reversed) Intronic