ID: 1052936814

View in Genome Browser
Species Human (GRCh38)
Location 9:34100034-34100056
Sequence TCTCTCTTTTTTTAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936808_1052936814 -6 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936805_1052936814 27 Left 1052936805 9:34099984-34100006 CCTCTAGAGCAGTGGTACTTAAC No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936807_1052936814 5 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936803_1052936814 29 Left 1052936803 9:34099982-34100004 CCCCTCTAGAGCAGTGGTACTTA No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data
1052936804_1052936814 28 Left 1052936804 9:34099983-34100005 CCCTCTAGAGCAGTGGTACTTAA No data
Right 1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936814 Original CRISPR TCTCTCTTTTTTTAGAGACA GGG Intronic