ID: 1052936816

View in Genome Browser
Species Human (GRCh38)
Location 9:34100046-34100068
Sequence TAGAGACAGGGTCTCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936809_1052936816 -1 Left 1052936809 9:34100024-34100046 CCCCCTTATGTCTCTCTTTTTTT No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936811_1052936816 -3 Left 1052936811 9:34100026-34100048 CCCTTATGTCTCTCTTTTTTTAG No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936807_1052936816 17 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936810_1052936816 -2 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936812_1052936816 -4 Left 1052936812 9:34100027-34100049 CCTTATGTCTCTCTTTTTTTAGA No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data
1052936808_1052936816 6 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936816 9:34100046-34100068 TAGAGACAGGGTCTCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936816 Original CRISPR TAGAGACAGGGTCTCACTTT GGG Intronic