ID: 1052936819

View in Genome Browser
Species Human (GRCh38)
Location 9:34100054-34100076
Sequence GGGTCTCACTTTGGGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052936808_1052936819 14 Left 1052936808 9:34100017-34100039 CCTTGGACCCCCTTATGTCTCTC No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936807_1052936819 25 Left 1052936807 9:34100006-34100028 CCTTTTTTGAGCCTTGGACCCCC No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936810_1052936819 6 Left 1052936810 9:34100025-34100047 CCCCTTATGTCTCTCTTTTTTTA No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936809_1052936819 7 Left 1052936809 9:34100024-34100046 CCCCCTTATGTCTCTCTTTTTTT No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936811_1052936819 5 Left 1052936811 9:34100026-34100048 CCCTTATGTCTCTCTTTTTTTAG No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data
1052936812_1052936819 4 Left 1052936812 9:34100027-34100049 CCTTATGTCTCTCTTTTTTTAGA No data
Right 1052936819 9:34100054-34100076 GGGTCTCACTTTGGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052936819 Original CRISPR GGGTCTCACTTTGGGGCCCA GGG Intronic