ID: 1052959948

View in Genome Browser
Species Human (GRCh38)
Location 9:34286858-34286880
Sequence ACCTCAGCCCGATTCAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052959938_1052959948 -6 Left 1052959938 9:34286841-34286863 CCAACCCCACCCTCCTGACCTCA 0: 1
1: 1
2: 9
3: 122
4: 1016
Right 1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1052959939_1052959948 -10 Left 1052959939 9:34286845-34286867 CCCCACCCTCCTGACCTCAGCCC 0: 1
1: 1
2: 16
3: 141
4: 1270
Right 1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1052959936_1052959948 -2 Left 1052959936 9:34286837-34286859 CCTCCCAACCCCACCCTCCTGAC 0: 1
1: 3
2: 22
3: 153
4: 1219
Right 1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1052959937_1052959948 -5 Left 1052959937 9:34286840-34286862 CCCAACCCCACCCTCCTGACCTC 0: 1
1: 0
2: 11
3: 100
4: 818
Right 1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1052959935_1052959948 1 Left 1052959935 9:34286834-34286856 CCTCCTCCCAACCCCACCCTCCT 0: 1
1: 4
2: 39
3: 352
4: 2696
Right 1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052959948 Original CRISPR ACCTCAGCCCGATTCAGGGG TGG Intronic
900206266 1:1433168-1433190 CCCTCAGCTCGGGTCAGGGGTGG + Intergenic
904701046 1:32358178-32358200 TCCTCAGCCCTCTTCAGGGCTGG + Intronic
905401461 1:37706699-37706721 ACCTCAGCCCCTGTGAGGGGAGG + Intronic
905932606 1:41800241-41800263 AGCCCAGCCAGATTCAGGGGAGG - Intronic
906690380 1:47788843-47788865 ACATGAGCCGGACTCAGGGGTGG - Intronic
907382857 1:54105416-54105438 ACCTCAGCCAGTCTCATGGGAGG - Intronic
909038467 1:70622446-70622468 GACTCAGCCCGATTCTGAGGAGG + Intergenic
909055717 1:70818403-70818425 CCCTCAGCCTGATTCAAGGGAGG - Intergenic
912901406 1:113653886-113653908 ACCTCTGCCCGGTTCAGGCGGGG - Exonic
915551096 1:156634890-156634912 ACTACAGCCCCACTCAGGGGTGG - Intergenic
919860470 1:201736595-201736617 CCCTCAGCCAGATTCCTGGGAGG - Intronic
921260706 1:213383187-213383209 ACCTGGTCCCCATTCAGGGGGGG - Intergenic
1067712292 10:48658785-48658807 ACCTCAGCCCTGGTCAGGTGGGG + Intergenic
1070154424 10:73824808-73824830 ACCTCAGCACCATCCAGAGGTGG + Intronic
1070163026 10:73877051-73877073 ACATCATCCCGACTGAGGGGAGG + Intergenic
1072741126 10:97910609-97910631 ACCTCTGCCCCATCCAGAGGCGG - Intronic
1083739319 11:64700105-64700127 ACCTCAGTCCCCTTCAGGGTTGG + Intronic
1084331697 11:68434096-68434118 ACCTGAGGCACATTCAGGGGTGG + Intronic
1089442879 11:118531162-118531184 ACCGCAGTCCGCTGCAGGGGCGG - Exonic
1090357366 11:126148986-126149008 ACTTTAGCCCTATTCAGGGCTGG + Intergenic
1091796432 12:3299944-3299966 CCCTCTGCACGATTCAGGGTGGG - Intergenic
1094705434 12:32910044-32910066 TCCTCAGCCAGATACAGAGGAGG + Intergenic
1101885819 12:108660768-108660790 ACCTCAGTCTGATTAAGGAGAGG - Intronic
1128118460 15:65128276-65128298 ACCTCAGCCCAGATCAGGGAAGG + Intronic
1132879090 16:2153412-2153434 AGCTCAGCCAGGTTCAAGGGCGG - Exonic
1135874738 16:26187885-26187907 ACCTCAGCACCATTGATGGGTGG + Intergenic
1139489225 16:67277909-67277931 ACAGCAGGCAGATTCAGGGGAGG - Exonic
1139528510 16:67530336-67530358 GCCTCCGCCCGGTTCCGGGGTGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148850201 17:50550901-50550923 ACATCAGCCCCAGTCAGGTGAGG + Exonic
1150178061 17:63083158-63083180 ACAGCAGCCCCATTCAGGGGTGG - Intronic
1154109865 18:11557951-11557973 AACTCAGCCAGATTCTGGGTGGG - Intergenic
1158846515 18:61448600-61448622 AATTCAGCTCGATTCAGGGAAGG - Intronic
1160532466 18:79573545-79573567 ACCTGGGCCCGATGCAGGAGGGG + Intergenic
1160831406 19:1106347-1106369 GCCTCAGCCCCTTGCAGGGGTGG + Intronic
1163028606 19:14529002-14529024 GCCCCAGCCCCATTCTGGGGTGG - Intronic
1163460318 19:17433510-17433532 ATCTCAGCCAGAATCAGGTGAGG - Intronic
1167259932 19:48452650-48452672 GCCTCAGCCTGACTCTGGGGAGG - Intronic
1168034022 19:53704579-53704601 ACCTCAACCCAAGTCAAGGGAGG - Intergenic
1168041822 19:53764984-53765006 ACCTCAACCCAAGTCAAGGGAGG - Intergenic
926681168 2:15665202-15665224 ACCTCAGCCCCGAGCAGGGGTGG - Intergenic
928674555 2:33637538-33637560 ACCTCAGCCAAATGCAGTGGTGG + Intergenic
929687825 2:44049605-44049627 CCCTCAGCCCTTTTCAGTGGAGG + Intergenic
934163696 2:89275349-89275371 ATCCCAGCCCGGTTCAGTGGTGG - Intergenic
934203576 2:89907175-89907197 ATCCCAGCCCGGTTCAGTGGTGG + Intergenic
936578246 2:113672995-113673017 ACCTCTGCCCCAGTCAAGGGGGG + Intergenic
947733748 2:232444497-232444519 GCCTCAGCCCCATGCTGGGGAGG + Intergenic
1171401524 20:24875580-24875602 ACCCCAGCCTGATTCAGAGCTGG + Intergenic
1173672609 20:44809377-44809399 ACCTCAGCCAGAGCGAGGGGTGG - Intronic
1175494591 20:59404827-59404849 ACCTTAGCCAGATCCTGGGGAGG + Intergenic
1176260758 20:64178349-64178371 TCCTCAGACCCATTCAGGGGTGG + Intronic
1179347564 21:40574855-40574877 ACCTTAGCCAGGTGCAGGGGCGG - Intronic
1184566593 22:45295672-45295694 ACCTCAGCCCTGTCCAGTGGCGG - Exonic
954793690 3:53150536-53150558 GCCCAAGCCCGATGCAGGGGTGG - Intergenic
967306575 3:188065521-188065543 ACCTCAGCCAGCTTCAGAGATGG + Intergenic
968566528 4:1316416-1316438 ACCTTAACCCGAGTCAGGTGAGG - Intronic
974429789 4:61780824-61780846 ACATCAGCCTGATTCAGGATGGG - Intronic
979530717 4:121766362-121766384 AGGTCAGCCCTATTCAGGGTAGG + Intergenic
999710981 5:154318145-154318167 ACCCCAGCCCTATACAGGTGAGG + Intronic
1000365953 5:160491606-160491628 ATCACATCCTGATTCAGGGGAGG + Intergenic
1004751248 6:18565072-18565094 TCATCAGCCTGATTCAAGGGAGG + Intergenic
1008662887 6:53687142-53687164 ACCTCAGGCTTATTCAGGGCTGG + Intergenic
1014693723 6:124593481-124593503 ACCTCAGCCCTATGGAGGGGAGG - Intronic
1017000739 6:149995604-149995626 TCCTCAGCCCTATGCATGGGAGG + Intergenic
1019545179 7:1570645-1570667 AACTCATCCCGCTTCAGGGTGGG - Intronic
1020187567 7:5970639-5970661 ACCTCAGCCCGAGCCCGGCGAGG - Exonic
1020295350 7:6754131-6754153 ACCTCAGCCCGAGCCCGGCGAGG + Exonic
1022458312 7:30579000-30579022 ACCACTGCCCAATTCAGGTGAGG - Intergenic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1029415787 7:100442341-100442363 TCCTCAGCCTGATGCTGGGGAGG - Intergenic
1030865391 7:114696349-114696371 ACCTCAGCCCTATTGAGGCTGGG - Intergenic
1034219647 7:149433728-149433750 ACCTGATCCAGATTCAAGGGTGG - Intronic
1037522398 8:19692821-19692843 AGCTCAGCCAGATTCTGGGGAGG - Intronic
1037754457 8:21702187-21702209 ACCTCAGCTCCAATCAGGAGGGG + Intronic
1045614817 8:103897288-103897310 ACCACAGCCCTATTCAAGAGTGG - Intronic
1046741810 8:117837069-117837091 TCCTCAGCCCTATTCTGGGAAGG + Intronic
1048223898 8:132566678-132566700 ACCTCAGCCAGCTTTAGGAGAGG + Intergenic
1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG + Intronic
1055452124 9:76440544-76440566 ACCTCAGCCCCACACAGGGCAGG - Intronic
1059403882 9:114087986-114088008 TCCTCAGCCCCAGGCAGGGGAGG - Intronic
1061395916 9:130343250-130343272 ACCTCAGCCCCACAGAGGGGAGG - Intronic
1062560261 9:137138525-137138547 ACCTCAGCCCCAGTCAGTGCGGG + Intronic
1062657840 9:137613406-137613428 ACCTCAGGCCACCTCAGGGGGGG + Intronic
1185790686 X:2926870-2926892 ACCTCTGCCTGATTCTGAGGTGG + Intronic