ID: 1052963463

View in Genome Browser
Species Human (GRCh38)
Location 9:34319981-34320003
Sequence CTGTGAGACCAAATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052963457_1052963463 22 Left 1052963457 9:34319936-34319958 CCTGCCTCAATCAGTGTTCATAT 0: 1
1: 1
2: 0
3: 12
4: 182
Right 1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG No data
1052963458_1052963463 18 Left 1052963458 9:34319940-34319962 CCTCAATCAGTGTTCATATTTAT 0: 1
1: 1
2: 0
3: 24
4: 290
Right 1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG No data
1052963459_1052963463 -7 Left 1052963459 9:34319965-34319987 CCAAGTACCTTCTCACCTGTGAG 0: 1
1: 1
2: 1
3: 13
4: 211
Right 1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052963463 Original CRISPR CTGTGAGACCAAATGGAGCT AGG Intronic
No off target data available for this crispr