ID: 1052972077

View in Genome Browser
Species Human (GRCh38)
Location 9:34382684-34382706
Sequence CTGTAGTTTGGGAGGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052972070_1052972077 -1 Left 1052972070 9:34382662-34382684 CCTAATGGTGAAATATCAGTCAC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG 0: 1
1: 1
2: 3
3: 31
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052972077 Original CRISPR CTGTAGTTTGGGAGGTGGTG GGG Intronic
903001481 1:20269300-20269322 ATGAATTTTGGGGGGTGGTGGGG - Intergenic
903647745 1:24905050-24905072 CTGGGGTATGGGAGGTGCTGGGG + Intronic
903651511 1:24925315-24925337 GTGTGGTTTGGGCGGGGGTGGGG - Intronic
904062082 1:27719589-27719611 ATTGAATTTGGGAGGTGGTGAGG - Intergenic
904296843 1:29524756-29524778 CTGAAGGTTGGGAGAAGGTGCGG - Intergenic
904717069 1:32476451-32476473 CAGTAGTTGTGGAGGTGGAGAGG - Intronic
905034811 1:34911029-34911051 CTGTACACTGGAAGGTGGTGGGG - Intronic
905630195 1:39514316-39514338 CTGGAGTGGGGGAGGTGGAGAGG + Intronic
905667565 1:39771874-39771896 CTGGAGTGGGGGAGGTGGAGAGG - Intronic
905973956 1:42162294-42162316 GTGTGGTTTGGGATGTGGTCAGG + Intergenic
906772446 1:48497023-48497045 CAGCACTTTGGGAGGTGGAGAGG - Intergenic
907720057 1:56963571-56963593 GTGGAGGTTGGGGGGTGGTGGGG + Intronic
908683436 1:66688087-66688109 GTGTTGTTTGGGAGGTGGTAAGG + Intronic
908806205 1:67936067-67936089 CTGTAGTTTAGGAGGTAAAGAGG + Intergenic
909158433 1:72112771-72112793 CAGTAGTGAGGGAGGTGGAGTGG - Intronic
909797468 1:79759625-79759647 ATGTTGTTTGCCAGGTGGTGGGG - Intergenic
909961888 1:81856065-81856087 GTGGAGTTTGGAAGGTGGTGTGG + Intronic
911069440 1:93820867-93820889 CTCTAGGTTGGGTGGGGGTGGGG - Intronic
911261668 1:95693781-95693803 CTGTATTTCAGCAGGTGGTGAGG + Intergenic
911360772 1:96873459-96873481 CAGTTGTGTGGGAGGTGGGGAGG + Intergenic
913176431 1:116276966-116276988 CTGTTCTTTGGGATGGGGTGAGG - Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914718190 1:150268565-150268587 GTGAAGTTTGGGCGGAGGTGAGG - Exonic
915499493 1:156305449-156305471 CAGTAATTTGGGGGCTGGTGTGG - Intergenic
915538237 1:156550587-156550609 CTGTGGTTCTGGAGGTGCTGTGG - Intronic
918530911 1:185521370-185521392 CGGTACTTTGGGAGGCAGTGAGG - Intergenic
919869223 1:201808053-201808075 CTGTAGTTTGGGGGATGAGGGGG - Exonic
919951677 1:202370041-202370063 CAGTACTTTGGGAGGTGAGGTGG - Intronic
919953232 1:202386174-202386196 CAGTACTTTGGGAGGTCGGGTGG - Intronic
919988801 1:202694586-202694608 CTGTAGTTAGGGATGGTGTGTGG - Intronic
920160855 1:203996719-203996741 CTGTAGGTTGGGAGGGGGTAGGG + Intergenic
921114527 1:212075890-212075912 ATGTAGTTTAGCAGGTGTTGGGG - Intronic
923144675 1:231189753-231189775 GGGGACTTTGGGAGGTGGTGAGG - Intronic
923819405 1:237420523-237420545 CTCTCATTTGGGAGGAGGTGGGG + Intronic
924048622 1:240058255-240058277 ATGGAGTTTGGGAGTGGGTGAGG - Intronic
924190628 1:241548412-241548434 CTGTAACTGGGGAGGAGGTGGGG + Intronic
924444262 1:244114555-244114577 CTGTAATTTGGAAGGAGGTCAGG - Intergenic
1064641271 10:17418004-17418026 CTTGAGTTTGGGAGAGGGTGTGG + Intronic
1064948587 10:20820323-20820345 ATTTATTTTGGGAGGTGTTGTGG - Intronic
1065808285 10:29416174-29416196 CTGTAAATTGGGAGGTTTTGGGG + Intergenic
1068321480 10:55423656-55423678 CTGTAGTCTAGTAGGTGGTAAGG - Intronic
1068652162 10:59534450-59534472 GTGTAGTTGGAGAGGTGGTGAGG + Intergenic
1069047202 10:63755517-63755539 GAGTAGTTTGGGAACTGGTGTGG + Intergenic
1069512396 10:69052214-69052236 CTGGAGTGGGGAAGGTGGTGGGG + Intergenic
1072407450 10:95168542-95168564 CTGCAGTTGGGGAGGGGGAGGGG + Intergenic
1072477721 10:95779070-95779092 TTGGGGTTAGGGAGGTGGTGAGG - Intronic
1073876858 10:107934201-107934223 TTGTAGTTTGGCTGGAGGTGGGG + Intergenic
1074990184 10:118698737-118698759 CTGCAGTTTGGGAGGGCTTGGGG - Intronic
1075135776 10:119784849-119784871 CTGGAGTTTGGGAGGAAGTGAGG - Intronic
1076474289 10:130741756-130741778 TTTTAATTTGGGGGGTGGTGTGG + Intergenic
1077975553 11:7244760-7244782 CCGTACTTTGGGAAATGGTGTGG - Intronic
1078505953 11:11945686-11945708 CTGCACTTTGGGAGGCCGTGAGG + Intronic
1078851236 11:15165859-15165881 CAGTCTTTTGGGGGGTGGTGGGG + Intronic
1081347678 11:42010465-42010487 CTATAGTGAGGGAGATGGTGGGG + Intergenic
1082258842 11:50062282-50062304 CAGCACTTTGGGAGGTGGAGGGG - Intergenic
1083909466 11:65697595-65697617 CTGGAGTTTGGGAGGAGGTGGGG - Intergenic
1084818247 11:71664007-71664029 CTGTGGTGGGGGAGGTGATGTGG + Intergenic
1086019279 11:82206763-82206785 TTCTAGTTTGGGTGGGGGTGGGG + Intergenic
1089399645 11:118157016-118157038 CTGAAGTTTGGCAGGTGCCGAGG + Intergenic
1089698777 11:120231845-120231867 CTTTGGGTTGGGAGGGGGTGTGG - Intergenic
1090145476 11:124317019-124317041 CTCCAGTTTGGGAGGTAATGTGG + Intergenic
1090158139 11:124463452-124463474 CTGAGGTGTGGGAGGTGGTGGGG - Intergenic
1090261905 11:125327331-125327353 CTGGAGGTGGGGAGGTCGTGAGG + Intronic
1090708216 11:129359458-129359480 CTGGAGTTGGGGGGGTGGTGGGG - Intergenic
1091085919 11:132721709-132721731 CTGTGGTTTGTGCAGTGGTGGGG + Intronic
1091480500 12:824638-824660 CTGTAATTAGGGAGGTGCTATGG + Intronic
1091750685 12:3019687-3019709 CTACAGAGTGGGAGGTGGTGAGG - Intronic
1092754047 12:11746314-11746336 CACTAGCTTGGGAGATGGTGTGG - Intronic
1092819494 12:12340058-12340080 CAGTACTTTGGGAGGTTGAGGGG - Intronic
1094530312 12:31268259-31268281 CTGTACTTTGGGAGGCTGAGCGG - Intergenic
1095907611 12:47394089-47394111 AGGTAGGTAGGGAGGTGGTGGGG - Intergenic
1096316852 12:50575493-50575515 CTGGAGTTTGGGAGCTGAGGTGG - Intronic
1097587275 12:61529999-61530021 CTGAAATTTGGGAGGGGCTGGGG - Intergenic
1098140301 12:67444163-67444185 CAGCACTTTGGGAGGTGGGGTGG + Intergenic
1098919335 12:76289279-76289301 ATGGAGTTTGGGAGAGGGTGTGG - Intergenic
1099664098 12:85604325-85604347 CTGTTTTGTGGGAGGTGGCGGGG + Intergenic
1102454995 12:113065651-113065673 CTGGAGTAGGGGAGGTGATGCGG + Intronic
1103131292 12:118470814-118470836 CAGCACTTTGGGAGGTGGGGTGG + Intergenic
1103208427 12:119148925-119148947 CTGAAGGTAGGGAGCTGGTGAGG + Intronic
1103415559 12:120739871-120739893 CTGGTGTTGGGCAGGTGGTGGGG + Exonic
1103700484 12:122846636-122846658 CTGTAGTCGGGGAGGAGCTGCGG - Intronic
1103783187 12:123413193-123413215 CTTTTTTTTGGGGGGTGGTGGGG - Exonic
1104641836 12:130471983-130472005 CTTTGGCTTGGGAGGAGGTGAGG + Intronic
1104795241 12:131512501-131512523 CTGTAGACTGGGTGGTTGTGGGG - Intergenic
1104796227 12:131521400-131521422 CTGGTCTCTGGGAGGTGGTGTGG + Intergenic
1105852435 13:24347814-24347836 CTGTTGTTGGGGGGGTGGAGGGG + Intergenic
1105956574 13:25288325-25288347 CTGTAGTTGGGGGGTTGGTCTGG - Intergenic
1106017515 13:25883765-25883787 CAGCAGACTGGGAGGTGGTGAGG - Intronic
1106811632 13:33364114-33364136 CTGTAGATTTGGGGGTGGGGGGG - Intergenic
1107288993 13:38830671-38830693 CAGTAGGTTGGGAAGTTGTGTGG - Intronic
1107937963 13:45361161-45361183 CCGTGCTTTGGGAGGTGGAGGGG - Intergenic
1108470952 13:50766520-50766542 CCGAAGTTTGGTAAGTGGTGTGG - Intronic
1109019775 13:57074391-57074413 CTGTATTTTGGGAGGCTGAGGGG + Intergenic
1109642043 13:65203385-65203407 ATGAAGTTTGGGAGGGGCTGTGG + Intergenic
1111567676 13:90037555-90037577 CTGTAGATATGCAGGTGGTGGGG - Intergenic
1113134807 13:107077633-107077655 CTGCCGTGAGGGAGGTGGTGTGG - Intergenic
1113201432 13:107870311-107870333 CTGTATATTGGGAGGGGGTAAGG + Intergenic
1113449885 13:110401166-110401188 CTGTTAATTGGGAGGTGGGGAGG + Intronic
1118940257 14:70328482-70328504 CTATATTATGGGATGTGGTGAGG - Intronic
1119233845 14:73003302-73003324 CAGCACTTTGGGAGGTGGAGAGG - Intronic
1123099030 14:105783244-105783266 CTGTAATTTGGGCCTTGGTGGGG + Intergenic
1123780085 15:23617638-23617660 CAGCACTTTGGGAGGTGATGCGG - Intronic
1123907030 15:24931583-24931605 CTACACTTTGGGAGGTGGAGGGG + Intronic
1125077248 15:35633709-35633731 CTGCAGTTTGGGGTCTGGTGGGG - Intergenic
1125741622 15:41969254-41969276 GTGTAGTTTGGGATGGGGCGCGG + Intronic
1126412283 15:48384691-48384713 CAGTAGTTTTGGAGGTCCTGGGG - Intergenic
1126757125 15:51935734-51935756 ATGGAGTTTAGGAGTTGGTGTGG - Intronic
1127785109 15:62348930-62348952 CAGGAGTTAGGGATGTGGTGAGG - Intergenic
1127859574 15:62982014-62982036 ATGTAATTTGGGAGGTGGGGTGG - Intergenic
1128565839 15:68699991-68700013 CTGCAGCCTGGGAGGGGGTGGGG + Intronic
1129187847 15:73921376-73921398 CTGGAGAAGGGGAGGTGGTGTGG - Intergenic
1129327491 15:74808782-74808804 CTGCAGTCTGGGAGACGGTGAGG + Intergenic
1129680684 15:77656883-77656905 CAGTAGCTTGGGATGGGGTGGGG - Intronic
1131535374 15:93232848-93232870 CTGAATTTTGGGGGGTGGTGGGG + Intergenic
1132461511 16:57583-57605 GTGTGGTTTGGGGAGTGGTGTGG - Exonic
1132638179 16:963696-963718 CTGGAGTTTGCGTTGTGGTGAGG - Intronic
1134105036 16:11479113-11479135 CTGTACTTTGGGAGGGGGAAGGG + Intronic
1135381272 16:21998011-21998033 CTGTGGTTTGGGGGAAGGTGAGG - Intronic
1135772713 16:25229322-25229344 CTCTAGGTGGGGAGGTGGGGGGG + Intergenic
1137598577 16:49741070-49741092 CTGTAATTTGTGTGGTGGTGGGG - Intronic
1138064699 16:53928309-53928331 CTGTATTTTGGGAGGAGGGGAGG + Intronic
1138607889 16:58100230-58100252 CTGGACTTTGGGTGGTGGTGTGG - Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1141623587 16:85249809-85249831 CTGCAGTTTGGCAGGTGGGCAGG + Intergenic
1142547378 17:714481-714503 GTGGAGGTGGGGAGGTGGTGCGG - Intronic
1144566667 17:16365133-16365155 ATGTAGTTTGGGAGGTGGTGGGG - Intergenic
1146544253 17:33724678-33724700 CAGCAGTTTGGGAAGTAGTGGGG + Intronic
1146777279 17:35632130-35632152 TTGTTTTTTGGGGGGTGGTGGGG + Intronic
1147263984 17:39224346-39224368 CTGAAGTCTGGGAGGTGGCAGGG + Intronic
1147999744 17:44380720-44380742 CTCCAGTGGGGGAGGTGGTGTGG - Intronic
1148151490 17:45398932-45398954 CTGGAGTGTGGGAGGTGGTGGGG - Intronic
1148169235 17:45505387-45505409 CTGTAGCCTGGGAGGGGGAGTGG - Intergenic
1148278611 17:46329512-46329534 AAGTACTTTGGGTGGTGGTGAGG - Intronic
1148300821 17:46547374-46547396 AAGTACTTTGGGTGGTGGTGAGG - Intronic
1148364952 17:47048259-47048281 AAGTATTTTGGGTGGTGGTGAGG - Intergenic
1149571536 17:57675663-57675685 CTGGAGCCCGGGAGGTGGTGTGG + Intronic
1149588942 17:57813219-57813241 CTGCACTTTGGGAGGTCGGGGGG + Intergenic
1150400428 17:64851850-64851872 CTGTAGCCTGGGAGGGGGAGTGG - Intergenic
1150401682 17:64861889-64861911 AAGTACTTTGGGTGGTGGTGAGG + Intronic
1150649215 17:66998990-66999012 ATGTAGTTTGAGAGGTGGTGGGG + Intronic
1151050533 17:70973541-70973563 CTTTAGGTTAGGTGGTGGTGTGG + Intergenic
1151156172 17:72124121-72124143 CTGTAGTGTGGGAGGTTGAAGGG - Exonic
1151685073 17:75641443-75641465 CTGTACATTGGGAGGGGGTATGG + Intronic
1151820917 17:76496365-76496387 CCACAGTTAGGGAGGTGGTGGGG + Intronic
1151938094 17:77275981-77276003 CCGCACTTTGGGAGGTGGGGTGG - Intergenic
1151988077 17:77556764-77556786 CTGGAGCTGGGGAGGAGGTGAGG - Intergenic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152279025 17:79374334-79374356 CTGGTGTGTGGGTGGTGGTGCGG + Intronic
1152699904 17:81813597-81813619 CTGCAGTTTGGGAGGGGTGGTGG + Exonic
1152809674 17:82375560-82375582 CTGTGATTTGGGAGTTGGGGGGG - Exonic
1153283662 18:3437509-3437531 ATGTATTTTGGGAGTGGGTGAGG + Intronic
1154084831 18:11293551-11293573 CAGCACTTTGGGAGGTGGAGAGG + Intergenic
1154958272 18:21281222-21281244 CTGCCTTTGGGGAGGTGGTGTGG + Intronic
1155678353 18:28458102-28458124 CTGTGGTTTGGGATGTACTGTGG - Intergenic
1156388578 18:36628977-36628999 CTATAGTTTGGAATGTTGTGTGG - Intronic
1157414279 18:47489231-47489253 CTCTCCTTTGGGAGGTGATGAGG + Intergenic
1157675017 18:49562277-49562299 CTGTTTCTTGGGAGGGGGTGTGG + Exonic
1157684204 18:49629618-49629640 ATGCAGGGTGGGAGGTGGTGGGG + Intergenic
1159002823 18:62988467-62988489 CTGGAGGTTGGCGGGTGGTGTGG - Intergenic
1159856761 18:73598291-73598313 CCGTATTGTGGGATGTGGTGTGG + Intergenic
1160886617 19:1352725-1352747 CTGTGCTTTGGGAGGTGCTTTGG - Intergenic
1161223938 19:3133602-3133624 CTGGTGTCTGGGAGGAGGTGGGG + Intergenic
1161511520 19:4674919-4674941 CTGTAATTTGGGTTGTGCTGAGG + Intergenic
1161706464 19:5824393-5824415 CAGTGGAGTGGGAGGTGGTGGGG + Intronic
1162512211 19:11126175-11126197 CTTTAGTTTGGGGGCTGGGGTGG + Intronic
1162855710 19:13466982-13467004 CAGTGTTTTGGGAGGTGGGGAGG - Intronic
1162863439 19:13525450-13525472 CAGCACTTTGGGAGGTGGAGGGG + Intronic
1162999324 19:14356208-14356230 GTGTGGCTGGGGAGGTGGTGGGG + Intergenic
1163064807 19:14785144-14785166 GTGTGGCTGGGGAGGTGGTGGGG - Intergenic
1163261848 19:16195677-16195699 CAGCACTTTGGGAGGTGGGGCGG + Intergenic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163676581 19:18658368-18658390 AGGCAGTGTGGGAGGTGGTGTGG - Intronic
1165748011 19:38242141-38242163 GGGAAGGTTGGGAGGTGGTGAGG - Intergenic
1165772097 19:38385912-38385934 CTGCAGTGTGGGCGGCGGTGTGG + Exonic
1165996005 19:39844686-39844708 CTGTAATCTAGGAGATGGTGTGG - Intronic
1166361040 19:42253224-42253246 CTGGAGTGGGGGAGGTGGTGGGG - Intronic
1166552591 19:43676356-43676378 CTCTGGTTGGGGAGGTGGGGGGG + Intergenic
1166603533 19:44119187-44119209 ATGTAGTCAGAGAGGTGGTGGGG - Intronic
928321107 2:30283531-30283553 CTGTAGTCTGGGTGGAGCTGGGG + Intronic
929640027 2:43568792-43568814 CAGCACTTTGGGAGGTGGAGTGG + Intronic
930610883 2:53542092-53542114 GGGGAGGTTGGGAGGTGGTGAGG - Intronic
932415961 2:71574078-71574100 CACTAGTGTGGGAGCTGGTGGGG + Intronic
932657068 2:73619372-73619394 CTTTTTTTTTGGAGGTGGTGGGG - Intergenic
933427398 2:82130140-82130162 CTTTGGTTTTGGAGGTGGGGGGG - Intergenic
933822985 2:86131462-86131484 CAGCACTTTGGGAGGTGGTCAGG - Intronic
933978266 2:87529333-87529355 CTGTGCCTTGGGAGCTGGTGGGG + Intergenic
934942754 2:98514268-98514290 CTGGAGTTAGAGAGGGGGTGTGG + Intronic
936315568 2:111421468-111421490 CTGTGCCTTGGGAGCTGGTGGGG - Intergenic
937351813 2:121170303-121170325 CTGTTTTGGGGGAGGTGGTGAGG + Intergenic
937491640 2:122374851-122374873 CTTTAGTCTGGGAGGTTGGGAGG + Intergenic
937982947 2:127625572-127625594 CTCTCCTTTGGGAGGTGGGGGGG + Intronic
938222812 2:129586614-129586636 ATGTAGTGTAGGAGGGGGTGAGG - Intergenic
938377172 2:130815532-130815554 CTGCTGTGTGGGAGGTGGTGAGG + Intergenic
940980373 2:159994933-159994955 CTGTGGTGTGGGATGTGGGGTGG + Intronic
941479097 2:165983852-165983874 CAGTACTTTGGGAGGCGGGGCGG + Intergenic
942007789 2:171724304-171724326 GTGTGGTTTGGCAGCTGGTGTGG + Intronic
942045233 2:172095921-172095943 CTGTATTTTTGGAGGAGGAGAGG + Intergenic
942106901 2:172642344-172642366 ATGTAATTAGGAAGGTGGTGGGG + Intergenic
943642020 2:190370036-190370058 TTTTAGTTTGGAAGATGGTGGGG - Intronic
944032808 2:195257676-195257698 CTATGGGTTGGGAGGAGGTGAGG + Intergenic
944233132 2:197415920-197415942 CTGGGGTATGGGGGGTGGTGGGG - Intronic
944269502 2:197765362-197765384 CTGTAATTTTGGAGGTGTTTTGG - Intronic
948451187 2:238074054-238074076 CAGCAGTTTGGGAGGTGAAGCGG + Intronic
1168913645 20:1469292-1469314 CTGGAGGTTGGGGGCTGGTGTGG - Intronic
1168994248 20:2120887-2120909 CTGAAGCTTGGGTGGTGGGGAGG + Intronic
1170320422 20:15091017-15091039 CTATAGTTGGGGAGGTGGGTGGG - Intronic
1170850624 20:20000921-20000943 CTGTCTTCTAGGAGGTGGTGAGG - Exonic
1172643849 20:36457879-36457901 CAGCACTTTGGGAGGTGGGGTGG - Intronic
1172897588 20:38311496-38311518 CATTAGTTAGGGAGGTGTTGGGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173073934 20:39798024-39798046 CTGAAGTTTGGTCGGGGGTGGGG - Intergenic
1173560560 20:44002367-44002389 CTGGAGTTTCAGAGATGGTGGGG - Intronic
1173560764 20:44003812-44003834 CTGTGGTTAGAGGGGTGGTGGGG + Intronic
1173798254 20:45877862-45877884 CTTTAATTTGGGAGGAGGTGTGG - Exonic
1174984336 20:55432966-55432988 CTGGAGTCTGGGAGATGGAGAGG + Intergenic
1175192550 20:57221359-57221381 CTGTAAATTGGGAAATGGTGGGG - Intronic
1177659038 21:24058320-24058342 CCACAGTTTGGGAGGTGGTTGGG - Intergenic
1178317179 21:31576409-31576431 CACTAGTTTGGGAGGAGGGGAGG + Intergenic
1179300236 21:40101768-40101790 TTTTACTGTGGGAGGTGGTGGGG + Intronic
1179607539 21:42527067-42527089 GTGTAGTTGGGGAGCTTGTGTGG + Intronic
1180084187 21:45500358-45500380 GTGTAGTGTGTGAGGGGGTGGGG + Intronic
1180581632 22:16844544-16844566 CTGGAGTTTGGGAGGTGGGAGGG + Intergenic
1181317074 22:21977902-21977924 CTGTAGTATGGGAGCAGGGGAGG + Intronic
1183049597 22:35250130-35250152 CTGTGGGTTGGAATGTGGTGGGG - Intergenic
1183062004 22:35341911-35341933 CTGGAGTTTGGCTGGTGGTAAGG + Intronic
1183655020 22:39179612-39179634 CTGTAGGAGGGGAGCTGGTGGGG + Intergenic
1183984703 22:41563031-41563053 CTGTGGCTTGGGTGGTGGTGGGG - Intronic
1184462956 22:44649749-44649771 CAGCACTTTGGGAGGTGGAGAGG + Intergenic
949397073 3:3626097-3626119 TTGTAGGGTGGGAGGTGGGGTGG - Intergenic
949996442 3:9620909-9620931 CAGTAGTTTGGGAGGCTGAGGGG + Intergenic
950437239 3:12987255-12987277 CTGTGGGCTGGGAGGTGGTAGGG - Intronic
950938337 3:16866471-16866493 CTGGAGGTGGGGAGGTGGGGGGG - Intronic
951055625 3:18143293-18143315 ATATGTTTTGGGAGGTGGTGGGG - Intronic
951981603 3:28573052-28573074 CTGGAGGATGAGAGGTGGTGGGG + Intergenic
953084396 3:39652962-39652984 CAGCACTTTGGGAGGTGGAGTGG - Intergenic
953400481 3:42610252-42610274 CAGCACTTTGGGAGGCGGTGGGG - Intronic
954997100 3:54891720-54891742 CAGAACTCTGGGAGGTGGTGCGG + Intronic
955026327 3:55171216-55171238 CCATAGATTGTGAGGTGGTGAGG + Intergenic
955304829 3:57819997-57820019 CAGTGCTTTGGGAGGTGGAGGGG - Intronic
956020487 3:64928417-64928439 CAGTACTTTGGGAGGTCGAGGGG - Intergenic
956051085 3:65249213-65249235 CTGTAGTTGAGGGAGTGGTGTGG - Intergenic
956183004 3:66534767-66534789 CTCTAGTGTGGTAGGTGGAGAGG - Intergenic
956472625 3:69583977-69583999 TTTTGGTTTGGGAGGTGGGGAGG + Intergenic
958110406 3:89135208-89135230 CAGTCATTTAGGAGGTGGTGGGG - Intronic
959427362 3:106207532-106207554 CTGCACTTTGGGAGGTGAGGTGG + Intergenic
960908289 3:122623210-122623232 CTGTAATTTGCCAGATGGTGTGG - Intronic
961437630 3:126930541-126930563 CTGTCTTCTGGGAGGTGGTCAGG + Intronic
961645440 3:128390414-128390436 CTGTATTTTGGGAGGTAGAGGGG + Intronic
961831456 3:129625179-129625201 CTGTGTTTTGGGAGATGGGGTGG - Intergenic
962741222 3:138363821-138363843 CTGTGGTTTGGGGGGGGGGGGGG - Intronic
962750658 3:138432852-138432874 GGCTAGTTTGGGAGGGGGTGTGG - Intergenic
963705062 3:148676537-148676559 CAATAGTTTGGGAGGTGTCGGGG + Intergenic
963791419 3:149586743-149586765 CTGAAGGTTGGGATGTGGTGTGG - Intronic
963860346 3:150303402-150303424 CTCTATTTTGGGGGGTGGGGTGG + Intergenic
964677338 3:159298280-159298302 GAGTAGTTTGGGAAGTGGTAAGG - Intronic
965010241 3:163078439-163078461 CTAGAGTTTGGGAAGTGTTGTGG + Intergenic
966024655 3:175261243-175261265 CTGCAGTTTGGGATTTTGTGAGG - Intronic
966275394 3:178159769-178159791 CTGTTTTTTGGCAGGTGGTAGGG + Intergenic
966657315 3:182374148-182374170 GTGGAGGTTGGGAGGAGGTGAGG + Intergenic
968132424 3:196199295-196199317 AGGGAGTTTGGGAGGGGGTGAGG - Intronic
968515532 4:1013984-1014006 CTGTGGTTTGGGTGGAGGTGGGG + Intronic
969121005 4:4911131-4911153 CTGAAGTTTGAGAGGTGCTATGG - Intergenic
969238136 4:5881260-5881282 TGGTAGTTTGGGAAGTGGAGTGG - Intronic
970911376 4:21280316-21280338 CAAAAGTTTGGGAGGTGGAGAGG + Intronic
972861515 4:43174598-43174620 CAGCATTTTGGGAGGTGGGGCGG - Intergenic
973046755 4:45543012-45543034 CTGTAGTTTGGGAGTGTGTTTGG - Intergenic
973097434 4:46220040-46220062 CAGCACTTTGGGAGGTGGAGAGG - Intergenic
973722995 4:53744023-53744045 TTGTGGTTGGGCAGGTGGTGGGG + Intronic
976613407 4:87052429-87052451 GTTTATTTTGGGTGGTGGTGTGG - Intronic
976883264 4:89956392-89956414 ATGTACTTTGGGAGCTGGTGTGG - Intergenic
977873571 4:102123264-102123286 CTTTAGTTTGGGAGGAAGTAAGG - Intergenic
979109362 4:116732346-116732368 TTGTAATTTGAGAGGTGGTTTGG + Intergenic
980120293 4:128720939-128720961 CAGCACTTTGGGAGGCGGTGGGG - Intergenic
980167173 4:129242890-129242912 TTGGACTTTGGGAGATGGTGTGG + Intergenic
981681779 4:147407835-147407857 CTGTGGTTTAGGAGGTGGGGAGG - Intergenic
982673493 4:158349268-158349290 TTGAAGTTTGGGAGGTGTTTGGG - Intronic
982771466 4:159400928-159400950 CTGCAGGGTGGGAGGTGGAGCGG - Intergenic
983552150 4:169028584-169028606 CAGCACTTTGGGAGGTGGAGGGG + Intergenic
984383525 4:179026931-179026953 CAGTAGTTTGGGTGGTGATGCGG + Intergenic
985538910 5:478806-478828 CTGTGGTTTGGGGGTTTGTGTGG + Intronic
987131631 5:14865732-14865754 TTATACTTTGGGAGGAGGTGTGG + Intronic
988537730 5:32084034-32084056 CGGTAGTGCGGGTGGTGGTGGGG - Intronic
989223375 5:38995415-38995437 GGGGAGTTTGGGAGGAGGTGAGG + Intronic
989458845 5:41672967-41672989 CAGTAGTTCTGGAGGTGCTGGGG - Intergenic
989487164 5:42004781-42004803 CTGTAGAATGGGCGGTGGTGAGG + Intergenic
990564813 5:57018318-57018340 CTGGAGTCTGGGACGTGGTTGGG + Intergenic
990898935 5:60729249-60729271 CTGAAGTTGGGCAGGGGGTGGGG + Intergenic
992637851 5:78742304-78742326 CCGTACTTTGGGAGGTGAGGTGG + Intronic
994096989 5:95856514-95856536 CTTTTGTCTGGGAGGTGCTGGGG - Intronic
994510609 5:100698994-100699016 TTGTAGTTTGGAAGGAGGTAGGG - Intergenic
994582251 5:101658993-101659015 CAGCACTTTGGGAGGTGGAGAGG - Intergenic
994982274 5:106891011-106891033 CAGCAGTTTGGGAGGTGAGGCGG + Intergenic
996166985 5:120236317-120236339 CTCTAGTTGGAGAGGTAGTGTGG + Intergenic
996916760 5:128721528-128721550 ATCAAATTTGGGAGGTGGTGAGG + Intronic
998017597 5:138744982-138745004 CTGTGATTTGGGAGCTGCTGAGG - Intronic
998836316 5:146205446-146205468 GAGTAGTTTGGGAGGTGTGGAGG + Intronic
1000207423 5:159075772-159075794 CAGAAGGTTGGGAGGTGGTCTGG - Intronic
1001293869 5:170485376-170485398 CTTGAGTTTGGGATGTGGAGAGG - Intronic
1002089714 5:176797402-176797424 CTTTAGATTGGGAACTGGTGTGG + Intergenic
1003596058 6:7475251-7475273 CAGCACTTTGGGAGGTGGAGGGG - Intergenic
1004332389 6:14733763-14733785 TTGAAGTTTGGGAGGCAGTGGGG - Intergenic
1004540489 6:16544862-16544884 GTGTAGGTGGGGAGGTGGTGTGG + Intronic
1004681872 6:17903889-17903911 CAGTAATTTGGGAGGTGGTTAGG + Intronic
1008356754 6:50563706-50563728 CAGCACTTTGGGAGGTGGAGTGG - Intergenic
1010211269 6:73364179-73364201 CTGTATTTTGGAAGGTAGAGGGG + Intergenic
1010915592 6:81614047-81614069 TTGTTTTTTGGGGGGTGGTGGGG - Intronic
1011424528 6:87212300-87212322 CTGTTGTTTAGGAGGTCTTGTGG + Intronic
1011474021 6:87735043-87735065 CAGTACTTTGGGAGGCCGTGAGG - Intergenic
1013273627 6:108562641-108562663 CTGGCGTTTGGGAGGAGGTTTGG + Intronic
1014190868 6:118495264-118495286 ATGAAATTTGGGAGGTGCTGGGG + Intronic
1014193115 6:118521119-118521141 TTTTAGTTTGGGATATGGTGTGG - Intronic
1014258331 6:119186603-119186625 CTGTGGTCTGGGAAGTGCTGGGG - Intronic
1016338549 6:143035214-143035236 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1016848178 6:148590085-148590107 CTGAAGTTTGGGTGGCTGTGAGG - Intergenic
1017359280 6:153547163-153547185 CAGATGTTTGGGTGGTGGTGGGG - Intergenic
1017740952 6:157406183-157406205 CTGCAGTTGGGGAGGGAGTGGGG + Intronic
1018844433 6:167545980-167546002 TTGGAATTTGGGAGCTGGTGAGG - Intergenic
1019495558 7:1338416-1338438 CTGTATTTTGGGATGTAGTCAGG + Intergenic
1019548772 7:1592014-1592036 CTGTGGGTTGGCGGGTGGTGGGG + Intergenic
1022234477 7:28447647-28447669 GTGTATTGTGGGAAGTGGTGAGG + Intronic
1023370825 7:39510523-39510545 CTGTTGTGGGGGAGGTGGGGGGG + Intergenic
1023895900 7:44432633-44432655 CTGTATTTGGGGTGGTGGAGAGG - Intronic
1024376671 7:48646765-48646787 CAGCACTTTGGGAGGTGGAGGGG - Exonic
1025964835 7:66259134-66259156 CTGTATTTTGTGAGTAGGTGTGG + Intronic
1027725569 7:81801648-81801670 CTCTTCTTTGGGAGGTTGTGAGG + Intergenic
1027741138 7:82007251-82007273 CTATTGTTTGGGAGTTGGGGAGG + Intronic
1028042200 7:86067068-86067090 GTGTGGTTTGTGAGGTGGAGGGG + Intergenic
1028202764 7:87981518-87981540 ATGAAGAATGGGAGGTGGTGTGG + Intronic
1028236933 7:88373617-88373639 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1028278216 7:88886184-88886206 CTGAAATTTGGGAGGTTTTGTGG + Intronic
1028396023 7:90369530-90369552 CTGCAGCTTGGCAGGTGGAGGGG - Intronic
1028720605 7:94026658-94026680 CTGTAGAGGGGGAGGAGGTGAGG - Intergenic
1028918597 7:96286928-96286950 CTTTAGCTTGGGAGGTGGAAGGG - Intronic
1029356526 7:100056187-100056209 CAGCACTTTGGGAGGTGCTGAGG - Intronic
1029545984 7:101210821-101210843 CCGCATTTTGGGAGGTGGGGTGG - Intronic
1029566284 7:101340406-101340428 CTGTAGTATTGGAGGGGGTGCGG + Intergenic
1031415388 7:121489909-121489931 CTGGAGTTTGGGAGTTAGGGAGG - Intergenic
1032412824 7:131711316-131711338 TTGTAGGGTGGGAGGTGGGGGGG + Intergenic
1033157562 7:138970153-138970175 CTGTCGTCTGGGAGGAAGTGGGG - Intronic
1033664733 7:143429679-143429701 CAGAAGTTTGGGAGGTGAGGCGG - Intergenic
1034988693 7:155533952-155533974 CTGAGGTTTGGGAGGGGGAGGGG + Intergenic
1036688533 8:10927124-10927146 CGGTAGTTTGGGAGGGGCTGAGG + Intronic
1038119754 8:24599831-24599853 ATGTGGTTTGGGTGGTGGTTAGG - Intergenic
1038454988 8:27667187-27667209 CTGTAGTTTAGTAGTTAGTGTGG - Intronic
1038848902 8:31255232-31255254 CTGGTGTCTGGGAGGTGGTGGGG - Intergenic
1039369326 8:36968864-36968886 CTGTGGTTTGGGAGGACTTGTGG - Intergenic
1039948500 8:42150270-42150292 CTGTAGCCATGGAGGTGGTGAGG - Intergenic
1040029737 8:42813622-42813644 GTGGCGTTTGGGAGGTGGGGGGG + Intergenic
1047183812 8:122614172-122614194 CTGTGGTTGGGGTGGTGGGGGGG + Intergenic
1047501082 8:125442016-125442038 CTCTTTTTTGGGGGGTGGTGGGG - Intergenic
1048577767 8:135706440-135706462 GTGTAGTTTGGGAGGTAGGAGGG - Intergenic
1049021664 8:139961408-139961430 CTATGGTTTGGGTGGTGGTTTGG - Intronic
1052161676 9:25269005-25269027 CAGTTGTTTTGGAGGTTGTGGGG - Intergenic
1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG + Intronic
1052997805 9:34560349-34560371 CTGTAGGATGGGAGGCTGTGTGG + Intronic
1055288487 9:74756947-74756969 CAGTACTTTGGGAGGTGAGGTGG + Intronic
1055510010 9:76986686-76986708 CAGCACTTTGGGAGGTGGGGTGG + Intergenic
1055560788 9:77519644-77519666 ACGTAGGGTGGGAGGTGGTGAGG + Intronic
1055933098 9:81580015-81580037 CTGTTGTTTGTGAGGTGATAGGG - Intergenic
1055933912 9:81587634-81587656 CTGGAGTCTGGGAGGTGGCTGGG - Intronic
1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG + Exonic
1056540089 9:87563728-87563750 CTGCAGTCTGAGAGGCGGTGGGG - Intronic
1057987241 9:99729744-99729766 CTGCAGGTTGGGTGGGGGTGGGG - Intergenic
1058074609 9:100638007-100638029 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1059152982 9:111965952-111965974 CAGCACTTTGGGAGGTGGAGGGG + Intergenic
1059888397 9:118772517-118772539 CTTAAGGGTGGGAGGTGGTGTGG + Intergenic
1060226869 9:121797150-121797172 CTGCAGCTTGGGGCGTGGTGGGG - Intergenic
1060412910 9:123411788-123411810 CTGTATCTTGGGAGGCGGTCGGG + Intronic
1060972303 9:127745158-127745180 CTGTTCTTTGGGAAGGGGTGCGG - Intronic
1060980800 9:127790506-127790528 CAGTAGTTTGGACGGGGGTGGGG + Exonic
1062272255 9:135714863-135714885 CAGAAGTTTCGGAGGGGGTGCGG + Intronic
1185743393 X:2552052-2552074 CAGTACTTTGGGAGGCGGAGGGG - Intergenic
1185937163 X:4270747-4270769 CAGCACTTTGGGAGGTGGAGGGG + Intergenic
1186731985 X:12419920-12419942 ATGGAGTGTGGGAGGAGGTGAGG - Intronic
1187560213 X:20395581-20395603 GTGTAGGATGGGAGGTGGGGAGG + Intergenic
1188025371 X:25202708-25202730 CTGCAGTTAGGTAGGTTGTGGGG + Intergenic
1188306433 X:28565176-28565198 CTTTTGTTTGGGAGTTGGGGTGG + Intergenic
1188622378 X:32241789-32241811 CTGTATTTTGGGAGCAGATGAGG + Intronic
1191154031 X:57252149-57252171 CTGAAGTTTGGCAGGGGGAGGGG + Intergenic
1191716726 X:64198794-64198816 CTGTAGTTTGAGAGGAGTGGTGG - Intronic
1192039528 X:67603782-67603804 GTAAAGTTTGGAAGGTGGTGAGG + Intronic
1192189297 X:68981039-68981061 CTGGAGTTTGGGTGGCGGGGAGG - Intergenic
1192292809 X:69815424-69815446 CTGGAGTTGGGGTGGGGGTGGGG + Intronic
1193477249 X:81981860-81981882 CTGAAGTTTGGCAGGCGGAGGGG + Intergenic
1194270001 X:91800928-91800950 CAGTATTTTGGGAGGTGGAGTGG + Intronic
1196475482 X:116079671-116079693 CTGTATTTTGGCTGGTGATGTGG + Intergenic
1197481477 X:126991840-126991862 CTGTAATTTTGGAGTTGGTCTGG + Intergenic
1198005406 X:132489077-132489099 CTGAAGTTCTGGAGGTGGGGCGG - Intronic
1198051279 X:132955752-132955774 CTGTAAAGTGGGTGGTGGTGGGG - Intronic
1198365530 X:135936002-135936024 CTGTCGTGGGGTAGGTGGTGGGG - Intergenic
1198804488 X:140480782-140480804 TTGGTGTTTGGGTGGTGGTGGGG - Intergenic
1200587243 Y:5022367-5022389 CAGTATTTTGGGAGGTGGAGTGG + Intronic
1200857433 Y:7954358-7954380 ACGTTGTATGGGAGGTGGTGGGG + Intergenic
1200955707 Y:8943189-8943211 CTGTTGTTTGGTGGGTGGAGGGG - Intergenic
1201626280 Y:16018216-16018238 GTGTCCTTTGGGAGGTGATGAGG - Intergenic
1201770887 Y:17615689-17615711 CAGCACTTTGGGAGGTGGAGGGG - Intergenic
1201830668 Y:18290297-18290319 CAGCACTTTGGGAGGTGGAGGGG + Intergenic
1202036999 Y:20646010-20646032 CTGCAGTGTGGGTGGGGGTGGGG + Intergenic
1202594682 Y:26524448-26524470 CTGTTGTTTGGTAGGGGGAGGGG + Intergenic