ID: 1052975306

View in Genome Browser
Species Human (GRCh38)
Location 9:34405832-34405854
Sequence CTGGGGGGTGAGGGAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 2, 3: 87, 4: 787}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052975306_1052975315 1 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975315 9:34405856-34405878 CACACTCACCCAGCTTCACTTGG 0: 1
1: 0
2: 5
3: 20
4: 194
1052975306_1052975317 7 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975317 9:34405862-34405884 CACCCAGCTTCACTTGGAGCGGG 0: 1
1: 0
2: 2
3: 15
4: 192
1052975306_1052975316 6 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975316 9:34405861-34405883 TCACCCAGCTTCACTTGGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 183
1052975306_1052975322 26 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975322 9:34405881-34405903 CGGGGATGGTTTGTAATTCATGG 0: 1
1: 0
2: 0
3: 1
4: 58
1052975306_1052975321 12 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975321 9:34405867-34405889 AGCTTCACTTGGAGCGGGGATGG 0: 1
1: 0
2: 0
3: 22
4: 281
1052975306_1052975318 8 Left 1052975306 9:34405832-34405854 CCCACATCTCCCTCACCCCCCAG 0: 1
1: 0
2: 2
3: 87
4: 787
Right 1052975318 9:34405863-34405885 ACCCAGCTTCACTTGGAGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052975306 Original CRISPR CTGGGGGGTGAGGGAGATGT GGG (reversed) Intronic
900285268 1:1896022-1896044 CTGGGGGGTGGAGGAGGTGATGG + Intergenic
900327086 1:2113720-2113742 CTGGGGGGTGGGTGAGAGTTGGG + Intronic
900418646 1:2546242-2546264 GTGGGGGGTGAGGGGGGTGGGGG + Intergenic
900430362 1:2598523-2598545 CTGAGGGGTGTGGGACATGAGGG - Intronic
900567588 1:3341220-3341242 CTGGTGGGTGTGGCAGATGGCGG + Intronic
900814040 1:4829616-4829638 GTGGGGGGTGAGTGTGATTTTGG + Intergenic
900973607 1:6004927-6004949 CTGAGGGGTGAGGGTGGAGTGGG + Intronic
900973662 1:6005125-6005147 CTGAGGGGTGAGGGTGCAGTGGG + Intronic
900973686 1:6005205-6005227 CTGAGGGGTGAGGGTGGAGTAGG + Intronic
900973886 1:6005925-6005947 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973895 1:6005964-6005986 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973904 1:6006003-6006025 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973917 1:6006043-6006065 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973926 1:6006082-6006104 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973939 1:6006122-6006144 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973952 1:6006162-6006184 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973961 1:6006201-6006223 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973970 1:6006240-6006262 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973983 1:6006280-6006302 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973992 1:6006319-6006341 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974029 1:6006438-6006460 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974042 1:6006478-6006500 CTGAGGGGTGAGGGTGCAGTGGG - Intronic
900974074 1:6006581-6006603 CTGAGGGGTGAGGGTGAAGTGGG - Intronic
900974086 1:6006621-6006643 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974111 1:6006700-6006722 CTGAGGAGTGAGGGTGAAGTGGG - Intronic
900974120 1:6006740-6006762 CTGAGGGGTGAGGGTGGAGTAGG - Intronic
901150536 1:7098415-7098437 CTGCAGGGTGAGGGAGTTGGCGG + Intronic
901266479 1:7914327-7914349 GTGGCGGGTGGGGGGGATGTGGG - Intergenic
901291449 1:8127387-8127409 CTGGGGAAGGAGGGAGATGGAGG - Intergenic
901943429 1:12681632-12681654 GGGTGGGGTGAGGGAGATCTGGG + Intergenic
902509753 1:16959883-16959905 CTGGGGGGTGGGGGAAAGGCGGG - Intronic
902581125 1:17408339-17408361 CTTGGGGGTGGGGCAGAGGTGGG - Exonic
902604514 1:17561395-17561417 CTGGGAGGAGAGGGAGATGCTGG + Intronic
902788654 1:18749974-18749996 CAGTGGGGTGAGAGAGTTGTTGG + Intergenic
902838391 1:19060583-19060605 GTGGGGGGTGGGGGGGATGGTGG - Intergenic
903499343 1:23792926-23792948 CTTGGGGGTGGGGGAGGGGTGGG + Intronic
903929803 1:26855613-26855635 CTGGGAGGTGAGGAAGAAGCTGG + Exonic
903951210 1:26996995-26997017 CTGGAGGGTCAGGCAGGTGTGGG - Intronic
904326465 1:29729758-29729780 CTGTGGGGTGAGAGAGGTGTGGG + Intergenic
904367929 1:30028526-30028548 CTGGGGAGTGAAAGAGAGGTTGG - Intergenic
905031241 1:34885715-34885737 CTGGGCGGTGATGGAGATGCGGG + Exonic
905223700 1:36466210-36466232 TTGGGAGGAGAGGGAGATGCTGG + Exonic
905294349 1:36944729-36944751 CTTTGGGGTCAGAGAGATGTGGG + Intronic
905386631 1:37608950-37608972 CTGGGAGGTGAGGAAGGTGGGGG - Intergenic
905388178 1:37618735-37618757 CTGGGGTGTGGGTGAGCTGTGGG + Intronic
905410571 1:37765327-37765349 GTGGGGGGTGGGGCAGCTGTGGG + Intergenic
905795912 1:40816524-40816546 CTGGGGGATGAGGGAAGTATTGG + Intronic
906187258 1:43871463-43871485 ATGGGGTGTGAGGGAGAGGCTGG + Intronic
906187264 1:43871482-43871504 CTGGGGTGTGAGGGAGAGGATGG + Intronic
906187270 1:43871501-43871523 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187276 1:43871520-43871542 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187294 1:43871575-43871597 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187299 1:43871594-43871616 ATGGGGTGTGAGGGAGAAGATGG + Intronic
906187308 1:43871632-43871654 ATGGGGTGTGAGGGAGAAGATGG + Intronic
906187318 1:43871670-43871692 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187324 1:43871689-43871711 ATGGGGTGTGAGGGAGAGGCTGG + Intronic
906187331 1:43871708-43871730 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187356 1:43871800-43871822 ATGGGGTGTGAGGGAGAGGCTGG + Intronic
906187363 1:43871819-43871841 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187481 1:43872176-43872198 CTGGGGTGTGAGGGACAGGAGGG + Intronic
907085810 1:51672825-51672847 TGGGAGGGTGAGGGAAATGTGGG + Intronic
907450682 1:54543803-54543825 CAGGGGTGTGAGGGAGCAGTGGG + Intronic
907475562 1:54703068-54703090 GTGGAGGGTGAGGGAGATGAAGG - Intronic
908563164 1:65327145-65327167 CTTGGTGGAGAGGGAGATGGGGG + Intronic
908598225 1:65711141-65711163 CTGGGGGATGGGGCAGCTGTGGG - Intergenic
910950415 1:92641066-92641088 TTGGGGGTTGAGGGAGAAGAGGG + Intronic
910993576 1:93079913-93079935 ATGGGGGCTGAGGGAAATGTGGG + Intronic
912334167 1:108846996-108847018 CTGGGGGTTTAGGGAAATGGTGG - Intronic
912632742 1:111260895-111260917 TGGGTGGGTGAGGGAGAAGTGGG - Intergenic
912682751 1:111739429-111739451 CTGGGGGTGGAGGGAAAAGTGGG + Intronic
913088554 1:115460385-115460407 GTGGGGGATGAGGGAGATTCTGG + Intergenic
913333619 1:117687355-117687377 CTGGGGGAGAAGGGAGGTGTGGG + Intergenic
913450295 1:118988318-118988340 CCGAGGGGTGAGGGAGAGGGAGG + Intronic
914044985 1:144083871-144083893 CTGAGAGGTGAGGGAGCTGGGGG + Intergenic
914133125 1:144876815-144876837 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
914357429 1:146898928-146898950 CTGGGAGGGCAGGGCGATGTCGG - Intergenic
914399380 1:147302830-147302852 TTGGGGAGTTGGGGAGATGTTGG + Intergenic
914468500 1:147950943-147950965 CCGTGGGGAGAGGGAGATGGGGG + Intronic
914904597 1:151733540-151733562 CTGGCCAGTGAGGGAGAGGTGGG - Intergenic
915056686 1:153139300-153139322 GTGGGGGATGGGGGGGATGTTGG + Intergenic
915058036 1:153154810-153154832 TTGAGGGGTTAGTGAGATGTGGG - Intergenic
915126079 1:153666001-153666023 CTTTGGGGTGATGGGGATGTAGG + Intronic
915362245 1:155293161-155293183 CTGGCCGGTGAGGGGGATATTGG - Exonic
915840934 1:159212418-159212440 CTGGGGCTTGAGGGAGATGATGG - Intergenic
916096126 1:161352387-161352409 CTGGGAGGTCAAGGAGATCTGGG - Intronic
916415944 1:164592080-164592102 CTGGGGGGAAAGGCAGATGAAGG + Intronic
916424313 1:164666131-164666153 CTGGGAGGTGAGGGATTCGTGGG - Intronic
916590276 1:166183542-166183564 CTGGGGGGTGAGGGTGCCTTTGG - Intergenic
916847672 1:168669983-168670005 CTCAGGGGTGATGGAGCTGTGGG + Intergenic
918546774 1:185693558-185693580 CTGGGGGGTGAGGGTGGGATGGG + Intergenic
918852594 1:189711151-189711173 CTGTGGATTGAGGGTGATGTTGG - Intergenic
920036193 1:203067403-203067425 CTGGAGAGAGAGGGACATGTTGG + Intronic
920561475 1:206941955-206941977 CAGGGTGGTGAGGGAGGTCTGGG - Intronic
920596190 1:207272867-207272889 CTAGGGGTTGAGGGGGAGGTGGG - Intergenic
920950849 1:210570465-210570487 CTGGAGGGTGTGAGAGATGCTGG + Intronic
921141402 1:212310494-212310516 GTGGGGGATGGGGGAGAAGTAGG - Intronic
921249198 1:213280679-213280701 GTGTGGGGTGAGGGGAATGTGGG + Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
921665905 1:217870363-217870385 CTGGGGGGAGAGGCAGATGGTGG - Exonic
921860034 1:220033097-220033119 CTGGGAGGTTAGGGAGTAGTGGG - Intronic
922224069 1:223630116-223630138 CTGAGTGATGATGGAGATGTTGG - Intronic
922564478 1:226592821-226592843 CTGAGGAATGGGGGAGATGTGGG - Intronic
922567362 1:226609558-226609580 CTGGTTGATGAGGGAAATGTGGG + Intergenic
922823416 1:228500732-228500754 CTGGGGGGAGAGAGAGAGGCAGG + Intergenic
923199852 1:231700859-231700881 CTAGGGGTTGAAGGAAATGTAGG + Intronic
923738497 1:236634501-236634523 CTGGAGGGAGAGGGAGAAGCAGG + Intergenic
924350855 1:243113254-243113276 CTGGGTGGCTGGGGAGATGTTGG + Intergenic
1063032340 10:2248013-2248035 CTGTGAGGAGAGGGAGATGCCGG - Intergenic
1063375626 10:5552692-5552714 CTGGCGGGTGGTGGAGATGCAGG - Intergenic
1063613491 10:7582848-7582870 GTGGGGGGTGGGGCAGAAGTAGG + Intronic
1063655772 10:7986958-7986980 CTGGGGGAAGGGTGAGATGTGGG - Intronic
1064063270 10:12157990-12158012 CTGGAGGATGATGGGGATGTTGG - Exonic
1064957990 10:20932419-20932441 CTGGGGGGTGGGGGAGAAAGGGG + Intronic
1065533887 10:26699217-26699239 ATGGGGGGTGAGGGGCATGTGGG + Intronic
1065957142 10:30703926-30703948 CAGGGAGGATAGGGAGATGTTGG - Intergenic
1066957112 10:42183553-42183575 CTGAGAGGTGAGGGAGCTGGGGG + Intergenic
1067267330 10:44757303-44757325 ACGGGGGGTGGGGGAGATGGGGG - Intergenic
1067493634 10:46740539-46740561 CTGGAGAGTGAGGGAGACCTGGG - Intergenic
1067601025 10:47599865-47599887 CTGGAGAGTGAGGGAGACCTGGG + Intergenic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1067759101 10:49029904-49029926 CTGGTGGGAGAGGGTGATGGAGG + Intronic
1069016752 10:63438443-63438465 GTGTGGGGTGAGGCAGATGCAGG - Intronic
1069124149 10:64608018-64608040 TTGGGGGGAGTGGGAGATGAGGG + Intergenic
1069331863 10:67302277-67302299 ATGGGGGATTGGGGAGATGTTGG + Intronic
1069592464 10:69650605-69650627 CTGGGGGGTGGGGGTGCAGTGGG + Intergenic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069949280 10:72008197-72008219 CTGCGGGGTCAGGGGGATGCCGG - Exonic
1070174690 10:73960016-73960038 ATGGGAGCTGAAGGAGATGTAGG + Intergenic
1070411059 10:76140990-76141012 CTTAGGGGAGAGGGAGATGGGGG - Intronic
1070593033 10:77813625-77813647 CTGGGGCAGGAGGGTGATGTAGG - Intronic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1070655524 10:78268630-78268652 CTGGGGGGTAAGGGGGTTGGAGG - Intergenic
1070892037 10:79948255-79948277 CTGAGGGGTGAGGGAGCTGCGGG - Intronic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071216208 10:83405069-83405091 CTGGGGGGCAAGGAGGATGTGGG - Intergenic
1071256008 10:83872283-83872305 GTGGGAGGTAAGGGAGAGGTAGG - Intergenic
1071287842 10:84165457-84165479 CTTGAGGGTGAGGAAGAGGTGGG - Intergenic
1071404935 10:85320502-85320524 GTGGGGGATGAGGAAGATGTGGG - Intergenic
1071461189 10:85897863-85897885 GTGGGGGGTTGGGGAGATGGTGG - Intronic
1071511918 10:86267458-86267480 CTGGGTTGCCAGGGAGATGTAGG - Intronic
1071652568 10:87407735-87407757 CTGGAGAGTGAGGGAGACCTGGG + Intergenic
1071672170 10:87618903-87618925 GTGGGAGGTGAGGGAGAGGCGGG - Intergenic
1071722773 10:88163984-88164006 CTGGGGGTTCAGGAAGATCTGGG - Intergenic
1072223663 10:93348560-93348582 TTGGAAGGTGAGGGAGGTGTGGG + Intronic
1073036580 10:100567910-100567932 CTGGGGGAAGTGGGAGATGCAGG - Intergenic
1073439394 10:103543766-103543788 CTGGGGGCTGAAGGTGAGGTGGG + Intronic
1073453676 10:103623827-103623849 CTGGTGGGGCAGGGAGAGGTGGG + Intronic
1073561266 10:104498833-104498855 GGTGGGGGTGAGGGAGATGAAGG + Intergenic
1073599657 10:104834333-104834355 AGGGGAGGTGAGGGAGATATTGG - Intronic
1073726517 10:106237337-106237359 CTGTGGGGTGAGGGAAGGGTAGG - Intergenic
1074148856 10:110740586-110740608 CTGGTGGGAGAGGGAGACATGGG - Intronic
1074864909 10:117539326-117539348 CTGCGTGGAGTGGGAGATGTGGG - Intergenic
1075427865 10:122355910-122355932 CTGGGGGGTGAGGAAGGTCTGGG + Intergenic
1075988922 10:126816060-126816082 TAGGGGGGACAGGGAGATGTTGG + Intergenic
1076059703 10:127404186-127404208 ATGGTGGGAGAGGGAGATGGTGG - Intronic
1076063474 10:127430588-127430610 CTGGGGGGTGGGGCAGAAGATGG - Intronic
1076581363 10:131514056-131514078 CTGCGGGGTGAGGCAGGCGTTGG - Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1076810139 10:132882179-132882201 GTGGGGTGTGAGTGGGATGTGGG + Intronic
1076840506 10:133043004-133043026 CTGGGTCGCGAGGGAGATGGCGG + Intergenic
1077469628 11:2751083-2751105 CTGTGGGGTGCGGGGGCTGTGGG - Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078481893 11:11684293-11684315 CTGGAGGATTAGGGAGATATTGG + Intergenic
1078708146 11:13764873-13764895 CTGAGGGGTGAGGGAAAAGCAGG - Intergenic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079135232 11:17772736-17772758 CTGGGGGCCCAGGGAGATGCTGG + Intronic
1079474013 11:20808859-20808881 CTGGGGGCTGAGGGAGGGATGGG + Intronic
1080156840 11:29121020-29121042 GTTGGGGGTTGGGGAGATGTTGG - Intergenic
1080307770 11:30854919-30854941 CTGGGGGCTGAGGGCCATGAGGG + Intronic
1080688754 11:34537890-34537912 CTGGGGACTCAGGGAGTTGTTGG + Intergenic
1081176902 11:39939087-39939109 TAGGGGGGTTAGGAAGATGTTGG - Intergenic
1081300830 11:41449247-41449269 CTGGGGGCTTAGGCAGATGTTGG + Intronic
1081391172 11:42530558-42530580 CTGGAGGATGAGGGAGATCATGG - Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081854261 11:46294248-46294270 CTGGGGGCTGAGAGTGAGGTCGG + Intronic
1083554620 11:63616234-63616256 GGGGGGTGTCAGGGAGATGTTGG - Intronic
1083899497 11:65636743-65636765 CTGGGGGAGGGGGGAGAGGTTGG - Intronic
1083900582 11:65641426-65641448 CTCGGGGGTGAGGGTGAGCTAGG + Exonic
1084044462 11:66560709-66560731 CTGCGGGCTGAGGGTGATGTAGG - Exonic
1084151198 11:67288840-67288862 CTGGGGTGTGCGGGTGAAGTGGG - Intronic
1084166972 11:67379628-67379650 CTGGTGGGCGAGGGAGGAGTGGG - Intronic
1084470189 11:69354902-69354924 ATGGGGGGTGGGGAAGTTGTGGG + Intronic
1084643913 11:70443289-70443311 CAGGGGCGGGAGGGAGTTGTTGG - Intergenic
1084779970 11:71401622-71401644 GTGAGGGCTGAGGGAGATGATGG - Intergenic
1084949626 11:72657484-72657506 CTGGGGCCTGAGGGAGATGGAGG - Intronic
1085106965 11:73853105-73853127 GTGGGGGCTGGGGGAGAAGTGGG + Intronic
1085986666 11:81795952-81795974 CTGGTTGGTGTGGGAGTTGTGGG - Intergenic
1088066507 11:105726437-105726459 CTGGGGGGAGGGGCAGCTGTGGG + Intronic
1088595474 11:111437414-111437436 TTGGGGGATGAGGGGGATGCTGG + Intronic
1089073253 11:115717248-115717270 CTGGAGGATGAGGGAGGGGTGGG - Intergenic
1089196016 11:116694496-116694518 GTGTGGGGGGAGGGAGATGGTGG - Intergenic
1089250391 11:117155843-117155865 TTGGGGGGTGAGGGGAATGAGGG - Intronic
1089559863 11:119338396-119338418 TGGGGGGGTGAGGGAGAGGAGGG - Intergenic
1089775152 11:120830856-120830878 GTGGGGGGTGGGGGTGATGTGGG - Intronic
1090182507 11:124713108-124713130 ATGGGGGGATAGGGAGGTGTTGG - Intergenic
1090748133 11:129723496-129723518 CTGGGTGGGGAGGGAGGTGTTGG - Intergenic
1091586559 12:1820246-1820268 CGGGGGGGTGAGGGAGAGCCTGG + Exonic
1092121867 12:6050045-6050067 CTGGAAGGTGAGTGAGAGGTTGG - Intronic
1092231657 12:6779022-6779044 GTGGGGGGTGGGGCAGAGGTAGG - Intergenic
1094042579 12:26133296-26133318 TGGGGGAGTGAGGGAGATGAAGG - Intronic
1094084989 12:26580438-26580460 TTGGAGGCTGAGGGAGAGGTTGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094228375 12:28073380-28073402 ATTGGGGGTTGGGGAGATGTTGG + Intergenic
1095289348 12:40459517-40459539 GTGAGGGGTGAGGGAGAGGTGGG - Intronic
1096335382 12:50751393-50751415 CTTGGGGGTTAGGTGGATGTGGG + Intergenic
1096829083 12:54300718-54300740 CTGGGGGGTGAAGGAGGTGAGGG - Intronic
1096982636 12:55737231-55737253 CTGCCAGGTGAGGGAGCTGTTGG - Intergenic
1098186922 12:67906545-67906567 CTGGGGGTTTGGGGAGATGTTGG - Intergenic
1099111013 12:78561030-78561052 CTGGGGAGTGGGTGAGATGGAGG - Intergenic
1099141392 12:78980914-78980936 CAGGGGGGAGAGGGAGATGGAGG + Intronic
1100461013 12:94799241-94799263 CTGAGGAATGAGGGAGATGTTGG + Intergenic
1100473433 12:94914260-94914282 ATGGGAGGTGAGGGTGAGGTGGG - Intronic
1101416515 12:104513144-104513166 GTGGGGAGGGAGGGAGAGGTGGG + Intronic
1102147992 12:110669223-110669245 ATGGGGTGTGAGGGAGAAGGAGG - Intronic
1102552115 12:113698864-113698886 GTGGGGGGTCAGGGGGAGGTGGG + Intergenic
1102757761 12:115357108-115357130 ATGGGGGTAGAGGGAGATTTGGG + Intergenic
1102793956 12:115672607-115672629 GTGGGTGGAGAGGGAGATGGAGG - Intergenic
1103249856 12:119490149-119490171 CTTGGGGGTGGAGGAGATCTAGG - Intronic
1104038406 12:125114275-125114297 CTTGGGGGAGAGGGACATGGGGG + Intronic
1104284135 12:127407819-127407841 ATGGGGAGTTGGGGAGATGTTGG - Intergenic
1104448581 12:128852620-128852642 CTGTCGGGTGAGAAAGATGTTGG - Intergenic
1105545206 13:21346220-21346242 CTGGGTGGTTTTGGAGATGTTGG + Intergenic
1105552427 13:21410454-21410476 CTGGGGGAAGAGGCAGCTGTAGG - Intronic
1105578752 13:21675013-21675035 GTGGGGGCTGGGGGGGATGTGGG + Intronic
1106098346 13:26670343-26670365 TTGGGGGGTGAGGGACAAGGGGG + Intronic
1106361838 13:29038636-29038658 CTGGGGGATGGGGCAGCTGTGGG - Intronic
1106401697 13:29437140-29437162 CAGGGAGCTGGGGGAGATGTTGG + Intronic
1106565777 13:30883502-30883524 CTGAGGGGTGAGGGAGTGGCAGG - Intergenic
1106770139 13:32953783-32953805 TTGGGGGGTGAGGGAGGTGGTGG + Intergenic
1107015180 13:35702484-35702506 CTTGGCTATGAGGGAGATGTAGG - Intergenic
1107390341 13:39956687-39956709 CTGGGGTCTGGGGGAGATTTAGG - Intergenic
1108689286 13:52847360-52847382 CAGCGGGGTGATGGCGATGTCGG + Exonic
1108727767 13:53201036-53201058 CAGCGGGGTGATGGCGATGTCGG - Intergenic
1109128057 13:58543326-58543348 GTGGGGGGTGGGGAATATGTGGG + Intergenic
1109276875 13:60313359-60313381 CTGGGGCCTGAGGGAGGAGTAGG + Intergenic
1110169321 13:72482042-72482064 TTGGGGGATTAGGGAGATATTGG + Intergenic
1110192185 13:72743015-72743037 AGGGGTGGTGGGGGAGATGTTGG + Intronic
1110469692 13:75844934-75844956 CTGGGGAGTGTGGGGGAAGTGGG + Intronic
1111818081 13:93179957-93179979 CTGGTGGGTGAGGCTGAAGTGGG - Intergenic
1112647363 13:101349972-101349994 ATGAGGGTTGAGGGAGAAGTAGG - Intronic
1113263585 13:108592525-108592547 ATGGTGGGTGGGGGAAATGTGGG + Intergenic
1113381274 13:109808290-109808312 CTGAGGGGTAAGGCAGGTGTTGG - Intergenic
1113574732 13:111387145-111387167 CTGGGAGGGGAGGTAGATCTTGG + Intergenic
1113892688 13:113744556-113744578 CTGGGGGGAGAAGGAGCAGTTGG - Intergenic
1114164590 14:20207820-20207842 CTGGGAGGTTGGGGAGATGTTGG - Intergenic
1114260115 14:21030521-21030543 CTTGGGGGTGAAGGAGAAGGGGG - Exonic
1114311101 14:21468040-21468062 CTGAGGGATGAGGGGGATGGGGG + Intronic
1118137847 14:63047236-63047258 GTGGGGGGAGAGAGAGAGGTGGG - Intronic
1118346280 14:64943498-64943520 CTGGGGGATGAGGTGGAGGTGGG - Intronic
1118353750 14:64993664-64993686 CTGGGAGAGGAGGGAGATATAGG + Intronic
1118489923 14:66249036-66249058 CTGGAGGGTGAGGGGGAGGTGGG + Intergenic
1118735740 14:68700660-68700682 CAGAGGTGTGAGGGAGCTGTTGG + Intronic
1118810463 14:69269738-69269760 CTGTGTGGTGTGTGAGATGTGGG + Intronic
1119148043 14:72334062-72334084 CTCGGGGGTGTTGGAGATGGAGG - Intronic
1119445586 14:74660786-74660808 CTTGTGGGTGAGGGAGATGTTGG + Intronic
1120023463 14:79555638-79555660 CTGGGTGGTGAAGGATGTGTAGG + Intronic
1120855388 14:89207549-89207571 CTTGGGGGTGAAGGAGGTGGTGG + Intronic
1121111512 14:91316230-91316252 CTGGCCTGTGAGGGAGATGGTGG - Intronic
1121119178 14:91365160-91365182 GTGAGGGGTGAGGGAGTTGGAGG - Intronic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121522350 14:94594726-94594748 CAGGGGGGTGAGGGAGAGAAAGG - Intronic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1122270194 14:100565529-100565551 CTGGGGGGTGTGGGAGAGGAGGG + Intronic
1122655705 14:103258212-103258234 CTGGGTGCTGAGGGAGCCGTGGG + Intergenic
1122675104 14:103406214-103406236 TTGGGGGGTTAGGGGGGTGTCGG + Intronic
1122693789 14:103543279-103543301 CTGATGGGTGAGGGAGCAGTGGG + Intergenic
1122783333 14:104152939-104152961 CTGGGGGCAGAGGGACATGTGGG + Intronic
1122859761 14:104577335-104577357 CCGGTGGGTGGGGGAGATGGGGG - Intronic
1122881632 14:104692990-104693012 GTTGGGGCTGAGGGAGATGGAGG - Intronic
1122905607 14:104800354-104800376 CTGGGGTGTGAGGGGGGTTTAGG - Intergenic
1202935999 14_KI270725v1_random:88223-88245 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
1125288569 15:38120268-38120290 CTGGGGGAAGGGGGAGCTGTGGG + Intergenic
1125592752 15:40865010-40865032 CTGGGGAGTGAGGGAGCAGGAGG - Intergenic
1126195426 15:45925522-45925544 CTGGGGAGGGAGGATGATGTAGG - Intergenic
1126337088 15:47597723-47597745 ATGGGGAATGAGGGAGATGTTGG + Intronic
1126469208 15:48989278-48989300 CTGGGGGAGGAGGGAGGGGTGGG - Exonic
1126568635 15:50126852-50126874 CGGGGGGGTGTGGGGGCTGTGGG - Intronic
1127260763 15:57324498-57324520 CTGAGGGGGGAGGGACATGAGGG - Intergenic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128359819 15:66954124-66954146 CTGTTGGGTGAGGGAGTGGTGGG - Intergenic
1128632509 15:69280730-69280752 CTAGGGGTTGAGGGAAAGGTAGG - Intergenic
1128648328 15:69393088-69393110 CTGAGGGGAGAGGGAGGTGAGGG + Intronic
1128716467 15:69912242-69912264 CTGGAGGGTGAGTGAGGTGCAGG + Intergenic
1129163873 15:73764139-73764161 CTGGGGAGTGAGGGTGGTGGCGG + Intergenic
1129442249 15:75589788-75589810 GTGGGGGGTGAGGGAGAAGTGGG + Intergenic
1129655851 15:77525398-77525420 CTCGGGGGTGAGGGTAATGAGGG + Intergenic
1129770652 15:78201343-78201365 CTGGGGGGCAAGGGTGAGGTGGG - Intronic
1129772070 15:78208736-78208758 CTGGGAGGCGAGGGGGATCTGGG - Intronic
1130010278 15:80147375-80147397 CTGGGAGGTTGGGGAGATATTGG + Intergenic
1130151635 15:81315795-81315817 TTGGTGGGTGAGGGAGAGGGTGG + Intronic
1130260975 15:82354023-82354045 TTGGGGGGTGGGGGGGTTGTGGG + Intergenic
1130367784 15:83255758-83255780 CTGGAGGGTGGGGGAGAGTTTGG - Intergenic
1130606426 15:85321445-85321467 CTGGGGAGTGAGGGAGAACAGGG - Intergenic
1130717327 15:86348068-86348090 CTGGGAGGTGAAAGAGAAGTAGG - Intronic
1131148864 15:90034621-90034643 CTGGCGGGTGAGGCAGAGGCCGG - Intronic
1131357640 15:91759458-91759480 CTGTGGGCTATGGGAGATGTGGG - Intergenic
1131366502 15:91846312-91846334 GTGGGGGGAGAGGGAGAGGGAGG - Intergenic
1131494951 15:92900148-92900170 CTGGAGGGGCAGGGAGGTGTGGG + Exonic
1131517803 15:93090651-93090673 CTAGAGGGTGGGGAAGATGTTGG - Intergenic
1132044935 15:98555570-98555592 CTGCAGGGTGGGGGAGATGAAGG - Intergenic
1132090681 15:98945978-98946000 CTTGGGGGTGTGGAAGATGCGGG + Intronic
1132200294 15:99948855-99948877 ATGGGGTGTTGGGGAGATGTTGG - Intergenic
1132310204 15:100851908-100851930 GTGGGGGGTTGGGGTGATGTTGG + Intergenic
1132629989 16:912653-912675 CTGGGGCGTGAGCGAGGTGGAGG - Intronic
1133110801 16:3547008-3547030 CTGGGGCGTGAGGGAACTCTAGG - Intronic
1133301838 16:4787464-4787486 GTGGTGGGTGAGTGAGAGGTAGG - Exonic
1134124867 16:11609768-11609790 CTGGAGTGTGAGGGAGAAGTGGG - Intronic
1134208863 16:12259437-12259459 CTGCTGGGTGAGGGGGATGCTGG + Intronic
1134233062 16:12444387-12444409 CTGGATGCTGAGGGAGATGCAGG + Intronic
1134408599 16:13984130-13984152 TTGGGGGGTGAGGGATGGGTCGG - Intergenic
1136228461 16:28873755-28873777 CTAGGGGGTGATGGAGAGGAAGG + Exonic
1136539996 16:30923791-30923813 CTTGGGGGAGGGGGAGAGGTCGG + Intronic
1136579521 16:31143119-31143141 CGGGGGTGTGAGTGAGCTGTTGG - Intronic
1137299493 16:47134075-47134097 GTGAGGGGTGAGGGAGGTGGAGG + Intronic
1137606833 16:49792566-49792588 CTGTGTGGTGAGGGATCTGTGGG + Intronic
1137977964 16:53046889-53046911 CTGGGAGTTGAGGAAGAGGTTGG - Intergenic
1138149469 16:54642871-54642893 CTGGGTTCTGAGGGAGACGTAGG - Intergenic
1138339650 16:56280387-56280409 CTGGGGTCTGAGCAAGATGTGGG + Intronic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1139383374 16:66548598-66548620 CTGGGGGGAGAGGGTGGTGGTGG + Intronic
1139394587 16:66630324-66630346 CTGTGGGGAGAGGGAGAGGGAGG - Intronic
1139976757 16:70818366-70818388 CTGGGAGGGCAGGGCGATGTCGG + Exonic
1140042270 16:71415999-71416021 TTGGGGGATGAGGCAGCTGTTGG - Intergenic
1140499531 16:75421841-75421863 GTGTGGGGTGGGGGAGATCTTGG - Intronic
1141615101 16:85205970-85205992 CTGGTGGGAGAGACAGATGTCGG + Intergenic
1141659761 16:85435547-85435569 CTGGGGGCTGAGGGAGGGGAGGG + Intergenic
1141683578 16:85557406-85557428 GTGGGTGGGGAGGGTGATGTGGG + Intergenic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142399771 16:89852673-89852695 CCGGGGGGTGAGAGAGAAGACGG - Intronic
1143476968 17:7208413-7208435 CTGGCGGGAGAGGGGGCTGTTGG - Intronic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1143781929 17:9233576-9233598 CTGGGGAGGGAGGGAGGTTTTGG + Intronic
1144797302 17:17900909-17900931 CTGAGGGGTGTGGCAGCTGTGGG - Intronic
1145792993 17:27639344-27639366 CTGGGGGGTGGGGGAGGTGGAGG - Intronic
1146013819 17:29216800-29216822 TTGGGGGGCGAGGGAGAAGTAGG + Intergenic
1146074309 17:29713854-29713876 TTTGGGGGTGAGGGAGGTGGTGG - Intronic
1146076491 17:29735019-29735041 ATTGGGGGTGGGGGAGATGTTGG + Intronic
1146534745 17:33640237-33640259 ATGGGGGCTGAGGGAGTTTTGGG + Intronic
1146647077 17:34582597-34582619 CAGGGGGGCGAGGGTGAGGTGGG + Intronic
1147419273 17:40314153-40314175 CAGGTGGGTGAGGGATATGGCGG + Intronic
1147525314 17:41216713-41216735 CTGTGGGGTGGGGCAGCTGTGGG + Intronic
1147613842 17:41817035-41817057 CTGGGGGGGGAGGGACAGATGGG - Intronic
1147647528 17:42042833-42042855 CAGGAGGGTGAGGGACATGCAGG - Intronic
1147662117 17:42122361-42122383 GTGGGTGGTCAGGGAGAGGTAGG + Exonic
1147682437 17:42259439-42259461 CTTGGGGGTGAGGGAATGGTAGG + Intronic
1148638215 17:49165434-49165456 GTGGGGAGTGAGAGAGAGGTGGG - Intronic
1149536084 17:57434538-57434560 ATGGGGAAGGAGGGAGATGTTGG - Intronic
1149863006 17:60134616-60134638 CTGGGGGGTGGGGGAGGAGGGGG - Intergenic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1149899092 17:60457298-60457320 CTGGAGGGTGGGGGAGAGGGAGG - Intronic
1150041165 17:61863158-61863180 CTGGGGGAGGAGGGAGATACGGG - Intronic
1150872594 17:68929970-68929992 CTGGGGGGTGGGGGCGGTGGGGG + Intronic
1151191395 17:72400511-72400533 TTGGGGGGTGGGGGCGGTGTCGG + Intergenic
1151224738 17:72640061-72640083 CTGGGGTGTGTGGAAGATGAAGG + Intergenic
1151265539 17:72952460-72952482 CAGGGGGGTGGGGGATATGCGGG - Intronic
1151325761 17:73379098-73379120 CTGGGGAGTGAGTGATATGTGGG - Intronic
1151496805 17:74462891-74462913 CTGGGGGGTGCAGGAGGAGTGGG + Intergenic
1151669897 17:75566248-75566270 TTGGGGTTTGAGGGAGATGAGGG + Intronic
1151888881 17:76940496-76940518 CTCGTGGTTGAGGGAGCTGTGGG - Exonic
1153083368 18:1254872-1254894 TTGGGGGGTGGGCGGGATGTGGG + Intergenic
1153485416 18:5593188-5593210 CAGGGGGGTGGGGGTGAGGTGGG - Intronic
1153508722 18:5830421-5830443 CAGGAGGGGGAGGGAGAAGTGGG - Intergenic
1153551797 18:6270383-6270405 ATGCGGTGTGAGGGAGAAGTTGG - Intronic
1153806398 18:8712071-8712093 TTTGGGGGTGGGGGAGGTGTGGG - Intronic
1153975515 18:10265270-10265292 TTGGGGTGTGTGGGAGAAGTTGG + Intergenic
1154078740 18:11233375-11233397 CTGGAAGGACAGGGAGATGTTGG - Intergenic
1155113136 18:22736407-22736429 TTGGGGGTGGATGGAGATGTTGG + Intergenic
1155793547 18:30004786-30004808 CTTGGGGGTGGGGGAGATAGTGG + Intergenic
1156209016 18:34918998-34919020 CTGGGGAGGGAGGGTGATATAGG - Intergenic
1156460418 18:37318622-37318644 GTGGGGGGGGGGGGAGGTGTAGG - Intronic
1156521256 18:37724056-37724078 CTGGGGGCTGAGGGGCAGGTTGG + Intergenic
1156558027 18:38089540-38089562 CTGGGGGCTAAGGAAGATGGAGG + Intergenic
1156734853 18:40243465-40243487 CTGGGGAAACAGGGAGATGTTGG - Intergenic
1157334969 18:46731474-46731496 CTGGGGCGAGAGGGAGGTGAAGG - Intronic
1157514544 18:48301512-48301534 CAGGGGGCTGAGGGAGGAGTGGG + Intronic
1157692143 18:49692227-49692249 CTGGACAGAGAGGGAGATGTTGG + Intergenic
1158769933 18:60503557-60503579 TTTGGGGGTGGGGGAAATGTGGG - Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1160394912 18:78564057-78564079 GTGGGGGGTGTGGGAGGTGAGGG - Intergenic
1160505092 18:79422572-79422594 CAGGGGAGTGAGGGAGAGGGAGG + Intronic
1160779794 19:872652-872674 CGGGGGGGTGGGGGCGAGGTTGG + Intronic
1160817723 19:1043766-1043788 CCGGGAGGTGTGGGAGATGCTGG + Exonic
1160823386 19:1068300-1068322 CTGTGGGGTCAGGGTGATGGTGG + Intronic
1160834466 19:1118003-1118025 CTGGGGGTTACGGGAGATGCTGG + Intronic
1161016829 19:1987429-1987451 CTCGGGGATGACGGAGATGGGGG - Intronic
1161283416 19:3457429-3457451 GTGGGGGGTGAGGGACACCTGGG - Intronic
1161536366 19:4821513-4821535 CTGGGGGGTAACAGAGATATAGG - Intronic
1161983564 19:7642676-7642698 CAGGGGGGACAGGGAGAGGTGGG - Intronic
1162136035 19:8555797-8555819 CTGGGGGGTGAGAGGGGGGTCGG + Intronic
1162856357 19:13471439-13471461 CTGTAGGGGGAGGAAGATGTAGG - Intronic
1163198628 19:15745569-15745591 CTGGGGAGTGAGGGAGCGTTAGG - Intergenic
1165213231 19:34251937-34251959 ATGGAGGGTGAGGAAGAGGTAGG - Intergenic
1165229952 19:34380770-34380792 AGGGGGTGGGAGGGAGATGTGGG - Intronic
1165768864 19:38367023-38367045 CTTGGGGGTGAGGGAGAGCCAGG + Intronic
1165806692 19:38584722-38584744 CAGGGGGGTGAGGGCCAGGTTGG - Intronic
1165949802 19:39467941-39467963 CTGGGGGGTAAGGGAGCACTAGG - Intronic
1166331074 19:42078281-42078303 CTGTGAGGTGTGGGAGATGAGGG + Intronic
1166727530 19:45037815-45037837 CTGGGTGGGGAGGGAGGTGGAGG + Exonic
1166763097 19:45236661-45236683 CTGGGGGCTGAGGAAGAACTAGG + Intronic
1167044198 19:47040421-47040443 CTGGGGGGTGACAGAGAAGAGGG - Intronic
1167065604 19:47183624-47183646 TGGGGGAGTGGGGGAGATGTGGG - Intronic
1167163173 19:47780673-47780695 CAGGGGAGAGAGGGAGAAGTGGG - Intronic
1167410531 19:49341293-49341315 CTGGGGGGTGAGCCAGTTTTGGG + Exonic
1167427458 19:49436840-49436862 CTTGGGGGTGAGGGGGCTGGGGG - Intronic
1167451203 19:49570656-49570678 CTTGGGGGTCAGGGGGAAGTCGG - Intronic
1167456199 19:49597670-49597692 CCGGGGGTTGAGGCGGATGTCGG - Exonic
1167459449 19:49616595-49616617 TTGAGGGCTGAGGAAGATGTGGG + Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168370629 19:55831104-55831126 CGGGGGGGTGGGGGGGATGGGGG - Intronic
1168430844 19:56278762-56278784 CTGGGAGCTCAGGGAGCTGTTGG + Intronic
1168655352 19:58123500-58123522 CAGGGGGATGGGGGAAATGTGGG - Intergenic
1202684543 1_KI270712v1_random:37275-37297 CTGAGAGGTGAGGGAGCTGGGGG + Intergenic
925696984 2:6590734-6590756 CATGGGGGTGAGGGAGCTGGAGG + Intergenic
925862157 2:8189472-8189494 CTGGGCTGTGCTGGAGATGTGGG + Intergenic
926017780 2:9469642-9469664 GTGGGAGGTGAGGGAGAGGGAGG - Intronic
926126644 2:10276504-10276526 TGGGGAGGTGAGGGAGCTGTGGG - Intergenic
927026410 2:19073272-19073294 CCGAGGGCTGAGGGAGATTTAGG - Intergenic
927132621 2:20073284-20073306 CTGAGGGAGGTGGGAGATGTGGG - Intergenic
927433409 2:23046429-23046451 CTGGGGGAAGGGGGAGAGGTAGG - Intergenic
927600676 2:24437594-24437616 TTGGGGGGTGGGGGAGTTTTGGG + Intergenic
927779426 2:25927574-25927596 ATGGGGGGTGTGGGAGGTGGTGG - Exonic
927860389 2:26557029-26557051 CAGGAGGGAGAGGGAGGTGTGGG - Intronic
928209279 2:29311791-29311813 CTGGGGGATGGGGGCGATGTGGG + Intronic
928268436 2:29832461-29832483 TTGGGGGAAGAGGGATATGTAGG + Intronic
928627348 2:33153908-33153930 CTGGGGGGTGGAGGAAAAGTTGG + Intronic
929046887 2:37798845-37798867 CTGGGAGGAGAGGGAGAAGAGGG + Intergenic
929086259 2:38170337-38170359 TGGGGGGGTCAGGGAGATGGAGG + Intergenic
929446809 2:42008603-42008625 CTGGGGGCACAGGGAGCTGTTGG - Intergenic
929490529 2:42392261-42392283 CTGGCAGGGCAGGGAGATGTGGG - Intronic
929923907 2:46193680-46193702 CTGAAGGGGGAGGAAGATGTGGG + Intergenic
931615940 2:64158008-64158030 CTTGGGGGTGAGGGAATTCTTGG - Intergenic
932361074 2:71106299-71106321 TGGGGGGAAGAGGGAGATGTTGG + Intergenic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932873409 2:75426155-75426177 CTTTGGGGTGAGGGAGGTGAAGG - Intergenic
933316908 2:80726743-80726765 GTGGGGGGTGGGGGGGATGTAGG - Intergenic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
933893709 2:86791938-86791960 CAGGGAGGTGTGGGTGATGTGGG + Intronic
933981625 2:87555340-87555362 TTGGGGGGTGGGGGTGACGTGGG + Intergenic
934247176 2:90317571-90317593 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
934262150 2:91485032-91485054 CTGAGAGGTGAGGGAGCTGGGGG + Intergenic
934305199 2:91816018-91816040 CTGAGAGGTGAGGGAGCTGCGGG + Intergenic
934328058 2:92036730-92036752 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
934713276 2:96529094-96529116 CTGGTGATGGAGGGAGATGTGGG + Intergenic
934902653 2:98172673-98172695 CTTGGGGGTGGGGGAGATGGAGG + Intronic
935132125 2:100268655-100268677 CTGGGGGGAAGGGGAGATGGTGG - Intergenic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936374358 2:111927905-111927927 CAGGTGGGTGAGAGAGATATAGG - Intronic
937046554 2:118855008-118855030 CTGGTGGGTGGAGGAGAGGTGGG - Intergenic
937859086 2:126694282-126694304 ATGTGGGATGAGGGAGATGGTGG - Intronic
937917324 2:127105655-127105677 CTGGGGGATGGGGGAGAGGGGGG - Intronic
937967487 2:127525131-127525153 ATGGGGGGTGGGGGTGGTGTTGG + Intronic
938029726 2:127981724-127981746 CGTCGGGGTGAGGGAGCTGTCGG - Intronic
938393913 2:130927491-130927513 CTGGGGTGTGAGGGAGACAGGGG + Intronic
938849048 2:135241650-135241672 ATGAGGGGTGAGGAAGATGCAGG + Intronic
939005574 2:136782622-136782644 TTGGGGGGTTGGGGAGATGTTGG + Intronic
941076393 2:161010604-161010626 GTGGGGGGTGAGGGGGGTGGGGG + Intergenic
942879705 2:180844459-180844481 GTGGGGGCTGGGGGAGGTGTAGG + Intergenic
942938492 2:181588239-181588261 CTGAGGGATCAAGGAGATGTTGG - Intronic
943247880 2:185478387-185478409 CTGGTGGATGAGGGAGATGAGGG + Intergenic
943642286 2:190372897-190372919 CTGGAGTGTTTGGGAGATGTTGG - Intergenic
944060118 2:195563240-195563262 GTGGGGGGCGGGGGAGGTGTGGG - Intergenic
945409842 2:209495230-209495252 CTGGGGGAAGAGGGGGATGTGGG + Intronic
945442661 2:209898744-209898766 TAGGGGGTTGAGGGAGAGGTGGG - Intronic
946471968 2:219968995-219969017 CTGGGGCGTGTGGGAGGTGAGGG - Intergenic
946508551 2:220328494-220328516 ATGAGGGTTGAGGGAGATGTGGG - Intergenic
946671006 2:222104512-222104534 TTGGGAGGTGAGGGAGGTGGAGG - Intergenic
946708789 2:222485711-222485733 CTGGGGTGTGGGGAAGATGAAGG - Intronic
947185819 2:227454416-227454438 CTGGAGGGTGAGAGGGATGGAGG + Intergenic
947625353 2:231615047-231615069 GGGCGGGGTGAGGGAGTTGTGGG + Intergenic
947831139 2:233142621-233142643 CTGGGGGATGGGGGAGACCTGGG + Intronic
948256196 2:236569726-236569748 CACGGGGGAGAGAGAGATGTGGG + Exonic
948401154 2:237686589-237686611 GTGGGGGCTGAGGGAGGTGGTGG + Intronic
948636674 2:239342737-239342759 GTGAGGGCTGAGGGAGATGAGGG + Intronic
948775738 2:240287992-240288014 GTGGGGGCTGAGGGAGGTGCTGG - Intergenic
948911049 2:241002872-241002894 GTGGAGGGTGAGGGAGAGGAGGG - Intronic
1168814324 20:726444-726466 CTCTGGGGTGAGGCAGATCTGGG - Intergenic
1168935470 20:1661672-1661694 CTGAGGAGTGAGGTAGCTGTAGG + Intergenic
1170161669 20:13319755-13319777 CTAGAGGGTGAGAGAGACGTGGG + Intergenic
1170329034 20:15188245-15188267 CTGGGGGCAGAGGGAGGTGAAGG - Intronic
1171115068 20:22518549-22518571 GTGGGGAATGAGGGAGGTGTGGG + Intergenic
1171489322 20:25505312-25505334 CTGGGTGGTGGGGGAGATGCTGG + Intronic
1171796062 20:29567545-29567567 CTGAGGGGTGGGGGACAGGTTGG + Intergenic
1171852172 20:30316622-30316644 CTGAGGGGTGGGGGACAGGTTGG - Intergenic
1171982774 20:31638963-31638985 TTGGGGGCAGAGGGTGATGTGGG + Intronic
1172122379 20:32606097-32606119 CTGAGAGGTGAGGGAGAGATTGG - Intronic
1172292185 20:33784265-33784287 GGGGAGGGTGAGGGAGATGGGGG - Intronic
1172865296 20:38091624-38091646 ACGGGGGGTGGGGGAGAGGTTGG - Exonic
1173277918 20:41600623-41600645 ATGGGGGTTGAGGCAGATGAGGG - Intronic
1173527657 20:43745296-43745318 CTGGGAGGAGAGAGAGAAGTAGG - Intergenic
1173937665 20:46881396-46881418 CTGGGGAGGCAGGGAGATGGTGG - Intergenic
1174453205 20:50632165-50632187 CTGTGGGGTGGGGGATATATGGG - Intronic
1174750178 20:53104243-53104265 CTGGGGGGTGGGGGGAAGGTGGG + Intronic
1174965103 20:55204278-55204300 CTGGGGGGTGAGGGAAAGGGAGG - Intergenic
1175013828 20:55766669-55766691 GGGGAGGGTTAGGGAGATGTTGG + Intergenic
1175290084 20:57869820-57869842 CTGGGGTGGGAGGGATGTGTTGG - Intergenic
1175292099 20:57882703-57882725 CTGGAGGATGAGTCAGATGTGGG - Intergenic
1175365966 20:58456409-58456431 GTCGGGGGTGGGGGAGATGGAGG + Intergenic
1175509663 20:59515354-59515376 GTGGTGGGTGAGGGGGATCTGGG + Intergenic
1175575325 20:60056568-60056590 CTGTGGGGTGACAGAGCTGTGGG + Intronic
1175929697 20:62487837-62487859 CTGGGGGTGGAGGGAGAGGGAGG + Intergenic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1177539219 21:22469678-22469700 CGGGGGTGGGAGGTAGATGTTGG - Intergenic
1178415711 21:32403438-32403460 CAGAAGGGTGAGGGAGAGGTGGG - Intergenic
1178622397 21:34188026-34188048 CCAGGGGGAGAGGGAGCTGTGGG + Intergenic
1179339966 21:40497473-40497495 GTGGGGAGTTGGGGAGATGTTGG + Intronic
1179635606 21:42706774-42706796 CTGGGGGGTGAAGGGGATGGAGG - Intronic
1180280345 22:10687903-10687925 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
1180587567 22:16906440-16906462 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
1180654493 22:17408198-17408220 CTGGGGGGTGAGGGGGCTGAGGG - Intronic
1180764183 22:18234113-18234135 CTGGGAGGTGAGGGGGACCTAGG + Intergenic
1180771459 22:18390428-18390450 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
1180802841 22:18640043-18640065 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
1180946413 22:19696206-19696228 CTGGGGGCTGCGGGGGGTGTGGG - Intergenic
1180952473 22:19726811-19726833 CGGGGCGGTGAGGGCGCTGTGGG + Intergenic
1180996520 22:19968502-19968524 CCGGGGGGTGGGGGAGGTGAGGG - Intronic
1181004012 22:20001099-20001121 TTGGGGGGTGGGGGACATCTTGG + Intronic
1181171541 22:21012813-21012835 CTGGGGGCTCTGGGAGAGGTGGG - Intronic
1181177814 22:21047705-21047727 CTGGGGGGTCAGGGAGAGCTGGG + Intronic
1181218877 22:21355218-21355240 CTGGGAGGTGAGGGGGACCTAGG + Intergenic
1181569978 22:23763280-23763302 GCAGCGGGTGAGGGAGATGTGGG - Exonic
1181630180 22:24147074-24147096 CTGGGGGCAGAGGGGGCTGTGGG - Intronic
1181807393 22:25383402-25383424 TTGGGAGGTGAGGGAGCTGCAGG + Intronic
1182034833 22:27189777-27189799 TTGGTGGGTGAGGGATAGGTGGG - Intergenic
1182353419 22:29711287-29711309 CTGGGGGATGGGGGTGAGGTTGG - Intergenic
1182415822 22:30220984-30221006 CAGGGGGTAGAGGTAGATGTCGG - Intergenic
1182501942 22:30754395-30754417 CTGGGGGCTGAGCCAGATGCAGG + Intronic
1182555850 22:31127919-31127941 GTGGGGGATGGGAGAGATGTGGG - Intronic
1182657856 22:31904087-31904109 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1182657864 22:31904129-31904151 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1182657873 22:31904171-31904193 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1183221453 22:36516450-36516472 CAGGAGGGTGATGGAGATGGCGG + Intronic
1183315865 22:37136510-37136532 CTGGGTAGTGAGGGAGCTTTGGG - Intronic
1183390051 22:37540614-37540636 CAGTGGGCTGAGGGAGATGGAGG - Intergenic
1184133869 22:42534619-42534641 CTGGGGGGTGATGAAGTTTTAGG - Intergenic
1184329851 22:43820520-43820542 CTGATGGGTGTGGGAGATGCCGG - Intergenic
1184644176 22:45887171-45887193 CTGGAGAGTCAGGGAGATGGAGG + Intergenic
1185056422 22:48580971-48580993 CTGGAGGGTCAGGGAGAGGCAGG - Intronic
1185348139 22:50319572-50319594 GCGGGTGGTGAGGGAGATGGAGG - Intronic
1185367997 22:50445745-50445767 CTGTGGGGTGGGGGAGGTGGCGG + Exonic
1185393706 22:50576401-50576423 CTGGGTGAGGAGGGAGAGGTGGG - Intronic
1203233298 22_KI270731v1_random:131419-131441 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
949897668 3:8780404-8780426 CTGGGGTGTGATGGATGTGTGGG - Intronic
950033433 3:9867008-9867030 CTGCGCGGTGAGGGAGGTGTGGG + Exonic
950055076 3:10017788-10017810 CTGTGTGGTGAGGGAGGTGTCGG + Intergenic
950421734 3:12903536-12903558 CTGGGGCGTGACGAAGATGCTGG - Intronic
950753774 3:15155268-15155290 CTGGGTGGTGAGGGGTATGCTGG - Intergenic
950895178 3:16442734-16442756 TTGGGGGGTCAGGGAGATGCAGG - Intronic
951553015 3:23894541-23894563 TTGGGAGGAGAGGGAGATGGAGG - Intronic
952132191 3:30377601-30377623 CTGGGGGTTGAGGGGGAGGTGGG - Intergenic
952296109 3:32063532-32063554 CTGGGCTATCAGGGAGATGTAGG + Intronic
952668348 3:35935348-35935370 ATGGGTTGTGAGGGCGATGTAGG - Intergenic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
952835490 3:37598544-37598566 CAGGGGGGTCAGGAAGATCTTGG + Intronic
952972098 3:38657895-38657917 CTGGGGGTGGAGGGAGGTGTGGG + Intergenic
952974819 3:38684747-38684769 GTTGGGGGTGAGGGAGGGGTTGG + Intergenic
953019180 3:39103195-39103217 CTGGGGCATGAGGGATATGAGGG - Intronic
953558930 3:43969807-43969829 CTGGAGGGGGAGAGAGATGGAGG - Intergenic
953884776 3:46709013-46709035 CTGGTGGGTGAGACACATGTGGG + Intronic
953932516 3:47012778-47012800 CTGGGTGGTGAGGCAGTTCTGGG - Intergenic
954053126 3:47999098-47999120 CTGGGGGTGGAGGGAGGTGGTGG + Intronic
954316913 3:49806282-49806304 GTGGGGGGTGGGGGGGAGGTGGG + Intronic
954622506 3:52004104-52004126 CTGGGAGGGGAGGAAGCTGTGGG + Intergenic
955265944 3:57444868-57444890 CTGGGAGGGGAGGGAGAAGTGGG - Intronic
955805384 3:62728571-62728593 CTGGAGCTTGAGGGAGATTTTGG + Intronic
957794368 3:84984407-84984429 ATGGGAGGTAAGGGAGATGGAGG - Intronic
959735023 3:109648443-109648465 CTGGGGGAAGGGGCAGATGTGGG + Intergenic
959991763 3:112638860-112638882 CTGGGGGTTGAGGGAGGTTGGGG + Exonic
960089457 3:113624677-113624699 GTGGGGGGAGAGGGAGATGAGGG - Intronic
961120972 3:124369727-124369749 CGGGGGAGTTGGGGAGATGTTGG - Intronic
961456923 3:127028970-127028992 CTGGGGGAGGAGGGAGCTGGAGG - Intronic
962139694 3:132776114-132776136 GTGGGGGGTGGGAGAGAGGTGGG + Intergenic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962310152 3:134320542-134320564 CTGGGGGGTGGGGGTGCTGCAGG - Intergenic
962346453 3:134622824-134622846 CTGGGAGCTGAGGGGAATGTGGG - Intronic
962765766 3:138560915-138560937 CTGGGGGAAGGGGCAGATGTGGG + Intronic
962839604 3:139221861-139221883 CTAGGGGATGGGGGAGATGTAGG - Intronic
963451137 3:145482884-145482906 CGGGGGGCTGAGGGAGGTGGCGG - Intergenic
963537351 3:146544725-146544747 CTGGAGGGTGAAGGAGCTGGAGG + Exonic
963742907 3:149097829-149097851 ATGGGGGGAGGGGGAGAGGTGGG + Intergenic
963869086 3:150394927-150394949 ATTGGGGTTGAGGGGGATGTTGG - Intergenic
964478819 3:157121869-157121891 GTTGGGGGAAAGGGAGATGTAGG - Intergenic
965597320 3:170421579-170421601 GTGGTGTGTGAGGCAGATGTCGG + Intronic
965640766 3:170826372-170826394 CTGGGGGCGGGGGGAGATGGGGG + Intronic
966172240 3:177095205-177095227 CTAGGGGGAGAGGGGGGTGTTGG + Intronic
966434179 3:179864535-179864557 TTGAGGGGTTTGGGAGATGTTGG + Intronic
966631059 3:182075565-182075587 ATGGGGGTTGGGGGAGATGAAGG - Intergenic
966870503 3:184287327-184287349 GTGGGGGGTTAGGGAGATGGAGG + Intronic
966973248 3:185064472-185064494 CTGGGAGGTTGGGGAGCTGTTGG + Intergenic
968469079 4:769631-769653 CTGGAGGGTGAGGGAGACCTCGG - Exonic
968500150 4:946134-946156 GTGGGGGGTGACGGAGAAGGGGG - Intronic
968654492 4:1772683-1772705 CTGGGGGATGAGGGAGGGGCCGG + Intergenic
968927286 4:3556276-3556298 GGGCGGGGGGAGGGAGATGTGGG - Intergenic
968965811 4:3768602-3768624 TTGTGGGGTGGGGGAGATGGGGG - Intergenic
969033676 4:4233050-4233072 ATTGGGGGTTTGGGAGATGTTGG + Intergenic
969308888 4:6340680-6340702 CTGAGGGGTGAGGTAGAAGTGGG - Intronic
969348289 4:6582793-6582815 GTGGGGGGTGAGGGGGTGGTGGG - Intronic
969547623 4:7841887-7841909 TTAGGGGGTGAGGGAGAGGAGGG + Intronic
969569550 4:8000635-8000657 CTGTGGGGTGGGGGACATGAAGG - Intronic
969873284 4:10117494-10117516 GTGGGGGATGGGGGAGCTGTCGG + Intergenic
970168059 4:13260996-13261018 CTTTGAGGTTAGGGAGATGTGGG + Intergenic
970311356 4:14785643-14785665 CTGGGGGGGGAGGGAGAAATGGG + Intergenic
970331825 4:14994409-14994431 TTGGAGGGTGAGAGAGATGAAGG + Intergenic
970714305 4:18904138-18904160 GTGGGGGGTGGGGGAGAAGAAGG - Intergenic
970996679 4:22275552-22275574 GGGGGTGGGGAGGGAGATGTGGG + Intergenic
971149660 4:24018477-24018499 ATGTGGGGTGAGGGTGATGAGGG + Intergenic
971340389 4:25763470-25763492 CTATGGAGTGAGAGAGATGTGGG + Intronic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
971800878 4:31289197-31289219 TTGGGGGGGTAGGGAAATGTTGG - Intergenic
971893523 4:32558613-32558635 TTGGGGGGTGGGGGAGAAGGGGG + Intergenic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
975098348 4:70483540-70483562 TAGGGGGATGAGGGAGAAGTGGG - Intergenic
975379464 4:73681542-73681564 GTGGGGGTAGGGGGAGATGTTGG + Intergenic
975430562 4:74285187-74285209 TTGTGGGGTGAGGGGGATGGGGG + Intronic
976330448 4:83825311-83825333 CTGGGGATTGTGGGAGATGTTGG + Intergenic
976601992 4:86946439-86946461 GTGGGGGGTGGGGGTGATGTAGG - Intronic
976799257 4:88970235-88970257 CTGGGGGCTGAGGTAGATTTTGG - Intronic
979099586 4:116598714-116598736 CTGTGGGGTGACGGTGGTGTAGG - Intergenic
979251087 4:118567300-118567322 CTGGGTGGCTGGGGAGATGTTGG - Intergenic
980892254 4:138828408-138828430 CTAGGGGTTGGGGTAGATGTTGG + Intergenic
981138171 4:141236629-141236651 GTAGGGGGTGAGGGAGGAGTTGG + Intergenic
981180843 4:141742233-141742255 AGGGAGGGTTAGGGAGATGTTGG + Intergenic
981530222 4:145745355-145745377 CTAGGGGGTTAGGGGGAAGTGGG - Intronic
981937243 4:150250866-150250888 GTGGGGAGTGTGGGGGATGTTGG - Intronic
981937249 4:150250884-150250906 GTGGGGGGTGTGGGGGGTGTGGG - Intronic
981937349 4:150251167-150251189 TTGGGGGGTGTGGGGGATGTGGG - Intronic
981937365 4:150251203-150251225 GTGTGGGGTGTGGGGGATGTGGG - Intronic
981937472 4:150251510-150251532 GTGGGGGGTGTGGGGGGTGTGGG - Intronic
982740919 4:159056050-159056072 CTGGGAGGAGGGGGAGGTGTTGG - Intergenic
982762915 4:159308793-159308815 CTGGGGAGTTTGGGAGTTGTGGG + Intronic
985009738 4:185570130-185570152 CTGGGCAGTGGGGGAGAGGTGGG + Intergenic
985519607 5:367407-367429 ATGGGCGGTGAGGAAGGTGTTGG - Intronic
985543166 5:496014-496036 CTGGTGGGTGAGGGACAGGCTGG + Intronic
986735607 5:10665464-10665486 CTGGGGGGTGGGGGAGGTTGGGG - Intergenic
986949322 5:13062231-13062253 CTGGGGGAATTGGGAGATGTTGG + Intergenic
987681502 5:21142899-21142921 CTGGAGGGTGGGTGGGATGTTGG + Intergenic
988618267 5:32795554-32795576 CTGGGGGATGGGGCAGCTGTTGG + Intergenic
989145596 5:38246360-38246382 CTGTGGGGTGAGGGAAGTGTGGG + Intergenic
989556038 5:42796087-42796109 TTGTGGGGTGGGGGAGATGGGGG + Intronic
990174367 5:53090764-53090786 GTGGGGGGTGGGGGAGGTGCGGG + Exonic
990382432 5:55230890-55230912 CTTGCTGGTGAGGCAGATGTGGG - Intergenic
990475276 5:56156510-56156532 CTGAGGGGTGCTGGAGTTGTAGG + Intronic
990561760 5:56990582-56990604 CTGGGGAATGACGGAGATGGTGG - Intergenic
990987969 5:61658773-61658795 CGGAGGGGTGAGGCAGAAGTGGG + Intronic
992098001 5:73380597-73380619 CTGGGGGGTGGAGGAGGTGGGGG - Intergenic
992308881 5:75473583-75473605 GAGGAGGGTTAGGGAGATGTTGG + Intronic
992475957 5:77101858-77101880 CTGCGGGGTGGGGGAGAGATGGG + Intergenic
992733933 5:79699936-79699958 CTAGGTGGTCAGGGAGATGCAGG + Intronic
994883157 5:105524480-105524502 TTGGGGAGTCGGGGAGATGTTGG - Intergenic
995086621 5:108118439-108118461 GTGGAGGCTGAGGGAGATGAGGG - Intronic
995151994 5:108859342-108859364 TTGGGGGGTGAGGCAGGGGTCGG - Intronic
995802893 5:116018908-116018930 CTGTGGGGAGAGGGATATATGGG - Intronic
996708895 5:126524539-126524561 CTGGTGGATGAGGGGGATCTGGG - Intergenic
996836704 5:127801661-127801683 CTGGGGACTAAGGGAGAAGTTGG - Intergenic
997168797 5:131692690-131692712 TTGGGAGATAAGGGAGATGTTGG + Intronic
997932415 5:138083506-138083528 CTGTGAGGTGATGGAGCTGTGGG - Intergenic
998257825 5:140602263-140602285 CTGGGTTTTGAGGGAGATGTAGG - Intergenic
998371489 5:141664864-141664886 GTGGGGGGTGGGGGTGATGAGGG - Intronic
999279628 5:150356787-150356809 GTTGGGGGTGGGGGAGTTGTAGG + Intergenic
999411709 5:151355942-151355964 CTTAGGGGTGAAGCAGATGTGGG + Intergenic
999717429 5:154372687-154372709 CTGAGGGGTGAGGGAGCTCCGGG + Intronic
1000020563 5:157315109-157315131 TTGGGGAGGGAGGGAGATGCAGG - Intronic
1000242265 5:159419396-159419418 ATGGGGGGTTAGGGAGAGCTAGG + Intergenic
1000349036 5:160338393-160338415 TTGGGGGGTGGGGGAGTTGAGGG - Intronic
1000702712 5:164473292-164473314 CTGGGGGGGGGGGGCGTTGTTGG - Intergenic
1001470028 5:172005908-172005930 CTGGGGGGGCAGGGAGCTTTCGG - Intronic
1001506415 5:172283854-172283876 CCGGGGGTTGAGGTAGAAGTGGG - Exonic
1001793450 5:174481706-174481728 CTGAAAGGCGAGGGAGATGTTGG + Intergenic
1001831749 5:174794870-174794892 GTGGGGTGTGGGGGAGAGGTGGG - Intergenic
1001996848 5:176168750-176168772 CTGTAGGTTGAGGGAGAGGTAGG + Intergenic
1002101884 5:176861851-176861873 CTGGGGGTTGTGGGAGCTGAGGG + Intronic
1002199497 5:177519741-177519763 CTGGGCGGGGAGGGAGTTGAGGG - Intergenic
1002205248 5:177558325-177558347 CTGGGGAGAGAGGAAGAAGTAGG - Intergenic
1002273642 5:178089366-178089388 TTGGGGGGTGAGAGAGGTGAGGG - Intergenic
1002465377 5:179405779-179405801 CTGGGGGGTGGGGGCGAGGCTGG - Intergenic
1002598977 5:180343234-180343256 CTGGGAGGTGGGGGAGCTGCAGG - Intronic
1003122435 6:3329156-3329178 GTGGGGGATGAGGGAGGTGGGGG - Intronic
1003146827 6:3516684-3516706 ATGGGGAGTGGGGGAGATGACGG - Intergenic
1003146844 6:3516740-3516762 ATGGGGAGTGGGGGAGATGATGG - Intergenic
1003146901 6:3516922-3516944 ATGGGGAGTGGGGGAGATGACGG - Intergenic
1003146948 6:3517073-3517095 ATGGGGAGTGGGGGAGATGTTGG - Intergenic
1003146966 6:3517130-3517152 ATGGGGAGGGGGGGAGATGTTGG - Intergenic
1003147004 6:3517241-3517263 ATGGGGAGTGGGGGAGATGACGG - Intergenic
1003147023 6:3517298-3517320 ATGGGGAGTGGGGGAGATGTTGG - Intergenic
1004017984 6:11749679-11749701 CTGAGAGGTGAGGAAGATGGGGG + Intronic
1004207025 6:13600963-13600985 CTGATGGGAGAGGGAGATGTGGG + Intronic
1004347710 6:14863843-14863865 ATGGGGGGTGAGTGAGAGGTAGG + Intergenic
1004416649 6:15430701-15430723 CTGGGGGTTGTGGGACTTGTGGG + Intronic
1004595119 6:17092411-17092433 CATGGGGGTTTGGGAGATGTAGG - Intergenic
1004865748 6:19852567-19852589 CTGGGGGAGTAAGGAGATGTTGG - Intergenic
1005513527 6:26533191-26533213 GTGGGGGGTGAGGGAAAGGCTGG + Intergenic
1005929656 6:30474467-30474489 CTGTGGGGAGAGGGAGAGGGAGG - Intergenic
1006383196 6:33712916-33712938 CTGGGGGGAGAGGGGGAAATGGG - Intergenic
1007082707 6:39119765-39119787 GTGGGGGGTGTGGAAGATGGAGG - Intergenic
1007260545 6:40559981-40560003 CCTGGGGGTGAGGCAGGTGTGGG - Intronic
1007351575 6:41277404-41277426 GTGAGGGGTGAGAGAGATGCTGG - Intronic
1007398460 6:41590325-41590347 CTGGCGGATGAGGGAGGCGTAGG - Exonic
1007479696 6:42142104-42142126 CTGTGCGGTGAGAGAGGTGTGGG - Intronic
1007663749 6:43502437-43502459 CTGGGGCTTGAGGGAGATGGTGG + Intronic
1007933036 6:45709281-45709303 CTGGGTGGTTTGGGAGATATGGG + Intergenic
1008438203 6:51501097-51501119 CTGGAGTGTGCAGGAGATGTTGG + Intergenic
1008636127 6:53412654-53412676 CATGGGGGTGAGGGAGATTCTGG + Intergenic
1008900799 6:56613258-56613280 ATGTGGGATGTGGGAGATGTGGG - Intronic
1012824427 6:104128687-104128709 CTGAGGGGTGAGGCAGGTGAAGG + Intergenic
1012937348 6:105382141-105382163 GCGGGGGTTGGGGGAGATGTTGG + Intronic
1013468288 6:110436881-110436903 ATGGGGGAGGAGGGAGATTTCGG - Intronic
1015047926 6:128800151-128800173 TTGGGGGATTGGGGAGATGTTGG + Intergenic
1015570430 6:134615413-134615435 CTGAGGGGTGGGGGAGATTGAGG + Intergenic
1015591036 6:134823259-134823281 CTGTGGGGTGAGGAGGTTGTAGG - Intergenic
1016623188 6:146135910-146135932 TTGGGGGGTGAGGGGAAAGTGGG - Intronic
1017131727 6:151113625-151113647 CTGGAGGGTGAGGGAGGTGGTGG + Intergenic
1017408692 6:154147059-154147081 CTGGCTGCTGAGGGAGAGGTGGG + Intronic
1017572278 6:155758867-155758889 CTGGGGATTGAGGGATAAGTCGG - Intergenic
1017703717 6:157100231-157100253 CAGAGGGGTGGGGAAGATGTTGG - Intronic
1018030020 6:159834336-159834358 GTGGGGGGTGAGGGAGGGGTGGG - Intergenic
1018089619 6:160334297-160334319 CTGTGTGGGGAGGGAGAAGTTGG - Intergenic
1018706089 6:166464110-166464132 TTTGGGGGTGTGGGAGCTGTAGG - Intronic
1018891734 6:167987707-167987729 CTTCGGGGTGATGGAGATGCCGG - Intergenic
1019507573 7:1400315-1400337 CTGGGGGGTGAGGGTTGAGTGGG - Intergenic
1019711015 7:2518374-2518396 CTGGGTGGTGTGGGGGATGGGGG - Intronic
1019924181 7:4181540-4181562 TTGGGAGGGGAGGGAGATGGGGG - Intronic
1020428437 7:8095253-8095275 CTGGGGGGTGGGGGGGTTGGGGG + Intergenic
1021000486 7:15324565-15324587 CTCAGGAGTGAGGGAGATGAGGG - Intronic
1021246900 7:18274455-18274477 CTTGGGGGTGAGTGAGTTCTTGG - Intronic
1021276944 7:18663449-18663471 CTGGGGGGTGAGGGGGAGGGAGG - Intronic
1021534499 7:21688209-21688231 CTGTGAGGGGAGAGAGATGTAGG - Intronic
1021804615 7:24342823-24342845 CTGAGGGATGAGGGAGAGGCAGG - Intergenic
1022353865 7:29592480-29592502 ATGTGGGGTGAGGAAGATGGAGG - Intergenic
1022467224 7:30660182-30660204 CTGGGGGCTGAGGGGAACGTAGG + Intronic
1023686343 7:42739330-42739352 CTGGCTGGTGAGAGAGATGACGG - Intergenic
1023768506 7:43533696-43533718 GTGGGGGCTGAGGCAGATGCAGG - Intronic
1023965399 7:44961244-44961266 CTGAGGGCTGAGGGAGCTGAGGG + Intergenic
1025818071 7:64937664-64937686 ATTGGGGGTGGAGGAGATGTTGG - Intergenic
1025944029 7:66092745-66092767 CTGGGGAGAGAGGAAGAGGTGGG - Intronic
1026038757 7:66848030-66848052 CTGGGGGGTGGGGGAGGGGAGGG + Intergenic
1026633593 7:72060639-72060661 TTGGGGCCTGTGGGAGATGTTGG + Intronic
1027212614 7:76163527-76163549 CTGGGGGGTGGGGGAGGGGAGGG - Intergenic
1027351305 7:77314525-77314547 CCGGGGGCTGCTGGAGATGTTGG - Intronic
1027414547 7:77961400-77961422 CTGGGGACTGAGGGAGAGTTGGG - Intergenic
1027596590 7:80182015-80182037 AAGGGGAGGGAGGGAGATGTGGG - Intronic
1028288164 7:89030546-89030568 CTGATGAGTGAGGGAGATGTAGG - Intronic
1028501643 7:91525669-91525691 CTGGGGTGTGGGGAAAATGTTGG + Intergenic
1028699150 7:93756729-93756751 CTGAGGGTTGAGGGGAATGTAGG - Intronic
1028773576 7:94655687-94655709 CTGGGCGGGGAGGGGGATGTTGG + Intronic
1029479307 7:100803173-100803195 CTGGGGAGGCTGGGAGATGTTGG + Exonic
1029495222 7:100892818-100892840 CCTGGGGGTGAGGGAGAGGGGGG + Exonic
1029744962 7:102511760-102511782 CTGGGGTGTCAGGGCGAGGTGGG + Intronic
1029762954 7:102610921-102610943 CTGGGGTGTCAGGGCGAGGTGGG + Intronic
1029987134 7:104932527-104932549 CTGGTGGGTGAGTGAGATGGTGG - Intergenic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1030297635 7:107944830-107944852 CTGGTGGGTGTGTGAGATGATGG - Intronic
1030371815 7:108708839-108708861 CTGGGCGGGGAGGGAGAGGGGGG - Intergenic
1030616406 7:111742560-111742582 CTAGTGGGAGAGGGAAATGTGGG - Intronic
1032214850 7:129949959-129949981 CTGGGGGTTGAGAAAGATGGTGG - Intronic
1032323908 7:130908849-130908871 TTGGGGGGATGGGGAGATGTGGG + Intergenic
1032401308 7:131626242-131626264 TGGGGGGATGAGGGAGAGGTGGG - Intergenic
1032783656 7:135184255-135184277 CTGGGAGTTGAGGGAAAAGTAGG - Exonic
1033326983 7:140388077-140388099 ATGGGGGTTTGGGGAGATGTTGG - Intronic
1033448060 7:141439128-141439150 CTTGGGGGTTAGTGAGCTGTGGG + Intronic
1033522984 7:142181490-142181512 CTATGGGGTGGGGGAGATGGGGG + Intronic
1034716835 7:153251219-153251241 CTGGGGGGTTGGGGAGAGCTGGG + Intergenic
1034937610 7:155210030-155210052 CTGGGAGGTGGGGGAGCTGGAGG + Intergenic
1035679708 8:1478896-1478918 CTGGAGGTTGAGGGAGATGACGG + Intergenic
1035794110 8:2337456-2337478 CTGGGGGAAGAGGCAGTTGTGGG + Intergenic
1035798695 8:2384252-2384274 CTGGGGGAAGAGGCAGTTGTGGG - Intergenic
1036073526 8:5468997-5469019 CGGGGGGGAGAGGGAGATATTGG + Intergenic
1036784523 8:11677168-11677190 CTGTGGGGAGAGGGAGGTGGGGG + Intronic
1036910517 8:12754533-12754555 CTGGGGGGTGTGGGAGGGGGCGG - Intronic
1037605898 8:20436927-20436949 CTGGGAGGAGAGGAAGATGTAGG - Intergenic
1037674070 8:21039429-21039451 CTGGGGGGTGAGAAAGATACAGG + Intergenic
1037952493 8:23028162-23028184 CTGGGGGGTGCACGGGATGTGGG + Intronic
1037963596 8:23117224-23117246 CTGGGGGGTGCACGGGATGTGGG - Exonic
1038960438 8:32512129-32512151 ATGGGGGATGAGGGGGATGGAGG + Intronic
1039753335 8:40497239-40497261 GTGGAGGGAGAGGGAGATGAAGG + Intergenic
1040022688 8:42754927-42754949 CTGGGGGTGCTGGGAGATGTGGG - Intronic
1040101502 8:43511067-43511089 TTGGGGGGTGAGTGAGAAGCTGG + Intergenic
1042491274 8:69401255-69401277 CTGGGGAATGAGGGAGGTGGGGG + Intergenic
1043961774 8:86424815-86424837 CTGTGGGGAGAGGGAGAGGGAGG + Intronic
1044407828 8:91850177-91850199 TTGGGGTATGAGGGAGAGGTGGG + Intergenic
1044880471 8:96718137-96718159 CTGAGGGGTGAGTGGGAAGTGGG - Intronic
1045528898 8:102965339-102965361 AAGGAGGGTGAGGGAGATGAAGG - Intronic
1045598635 8:103687651-103687673 ATGGGAGGTTAGGGAGATGTTGG - Intronic
1045797752 8:106065616-106065638 CTGGGGGAAGAGGCAGCTGTGGG + Intergenic
1048003892 8:130402690-130402712 TATGGGGGTGAGGGAGATGGTGG - Intronic
1048188516 8:132266305-132266327 CAGGGGATTGAGGGAGATGTGGG + Intronic
1048282193 8:133113855-133113877 CTGGGCCATGAGGGAGCTGTCGG + Intronic
1048572214 8:135665586-135665608 CTGCTGGGTGCAGGAGATGTAGG + Intergenic
1049310530 8:141931546-141931568 ACAGGGGGTGAGGGAGATGGAGG - Intergenic
1049600055 8:143503558-143503580 CTGGGTGCTGGGGGAGGTGTTGG - Intronic
1049696663 8:143987304-143987326 CTGAGGGGTGAGTGGGAAGTAGG - Intronic
1050230948 9:3525773-3525795 TTGGTGGGTGATGGAGATGGTGG + Exonic
1051065365 9:13095559-13095581 CGGGGGGGAGAAGGAGAAGTAGG + Intergenic
1051222852 9:14868869-14868891 CCGCGGGGTGAGGGTGATGAAGG - Exonic
1051916850 9:22218404-22218426 TGGGGGGTTGAGGGAGAAGTGGG + Intergenic
1052542837 9:29832964-29832986 CTGGGGGGCGGGGGATATGTTGG + Intergenic
1052975306 9:34405832-34405854 CTGGGGGGTGAGGGAGATGTGGG - Intronic
1052996880 9:34555885-34555907 ATGGCGGGGGAGGGAGATGGCGG - Intronic
1052996900 9:34555933-34555955 ATGGTGGGGGAGGGAGATGGCGG - Intronic
1052996907 9:34555949-34555971 ATGGCGGGGGAGGGAGATGGTGG - Intronic
1053564964 9:39239740-39239762 CTGGGGTGTGGAGGAGATATTGG + Intronic
1053696490 9:40644040-40644062 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
1053789954 9:41679880-41679902 CTGAGGGGTGGGGGACAGGTTGG - Intergenic
1053802210 9:41771686-41771708 GGGCGGGGGGAGGGAGATGTGGG - Intergenic
1053830742 9:42077615-42077637 CTGGGGTGTGGAGGAGATATTGG + Intronic
1054132186 9:61379299-61379321 CTGGGGTGTGGAGGAGATATTGG - Intergenic
1054155183 9:61634877-61634899 CTGAGGGGTGGGGGACAGGTTGG + Intergenic
1054178293 9:61891569-61891591 CTGAGGGGTGGGGGACAGGTTGG - Intergenic
1054307741 9:63443268-63443290 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
1054406467 9:64767270-64767292 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
1054440095 9:65252743-65252765 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
1054474975 9:65565985-65566007 CTGAGGGGTGGGGGACAGGTTGG + Intergenic
1054490310 9:65769196-65769218 CTGAGAGGTGAGGGAGCTGCGGG + Intergenic
1054599816 9:67109822-67109844 CTGGGGTGTGGAGGAGATATTGG - Intergenic
1054647875 9:67604745-67604767 GGGCGGGGGGAGGGAGATGTGGG + Intergenic
1054659236 9:67689255-67689277 CTGAGGGGTGGGGGACAGGTTGG + Intergenic
1054746593 9:68860179-68860201 CTGGGGGCTTGGGGAGATATTGG - Intronic
1055757698 9:79572977-79572999 CCGGGGGGTGGGGGTGATGGCGG - Intronic
1056931797 9:90883771-90883793 CTGGGGAGTGGGTGTGATGTGGG - Intronic
1057071104 9:92100726-92100748 CTGGGGGCTGGGGGAGAAGGCGG - Intronic
1057879153 9:98780140-98780162 CTTGGGGGCTAGGGAGATGGGGG - Intronic
1058001525 9:99870686-99870708 CTGGGGGGTGATGGCTTTGTGGG - Intergenic
1058049460 9:100392215-100392237 CTGGAGGGAGAGGGAGAGGGAGG - Intergenic
1058051239 9:100409063-100409085 CAGGGAGGCCAGGGAGATGTTGG + Intergenic
1058663203 9:107284051-107284073 CAGGTGGGGGAGGGAGACGTAGG + Intronic
1058818161 9:108704548-108704570 ATGGTGGGTGAGGAAGATGCTGG - Intergenic
1059114120 9:111585576-111585598 CTGAAGGGTTGGGGAGATGTTGG - Intronic
1059439769 9:114300547-114300569 CCCAGGGGTGAGGGAGCTGTGGG + Intronic
1060036427 9:120259898-120259920 CTGGGGAGAGAAGGAGATGGAGG - Intergenic
1060776485 9:126378478-126378500 CTGGGTGAGGAGTGAGATGTGGG - Intronic
1061147668 9:128809190-128809212 CTGCGGGCTGAGGGAGGTGCAGG + Exonic
1061900218 9:133668790-133668812 ATGGAGGGTGAGGGAGAGGGAGG - Intronic
1061900237 9:133668840-133668862 ATGGAGGGTGAGGGAGAGGGAGG - Intronic
1061900286 9:133668985-133669007 AGGGAGGGTGAGGGAGATGGAGG - Intronic
1061900309 9:133669050-133669072 ATGGAGGGTGAGGGAGAGGGAGG - Intronic
1061900358 9:133669195-133669217 AGGGAGGGTGAGGGAGATGGAGG - Intronic
1062253590 9:135610566-135610588 CTGAGCTGTGAGGGAGATGGGGG + Intergenic
1062378399 9:136275238-136275260 CTGGAGGGTGTGGGAGCTGGGGG + Intergenic
1202778938 9_KI270717v1_random:17700-17722 CTGAGAGGTGAGGGAGCTGCGGG - Intergenic
1203586009 Un_KI270747v1:4109-4131 CTGAGAGGTGAGGGAGGTGCGGG - Intergenic
1185634324 X:1540267-1540289 GTGGGGAGGGAGGGAGATGAAGG + Intergenic
1185957242 X:4504687-4504709 GTTGGGGGTTAGGGAGATGTTGG - Intergenic
1186408669 X:9326579-9326601 CTGGGGGCTGAGGGAGTCGCGGG - Intergenic
1187042697 X:15613549-15613571 GTGGTTAGTGAGGGAGATGTGGG + Intergenic
1187359342 X:18610214-18610236 CTGGGGGGTGGGGGAGAAAGTGG - Intronic
1187618821 X:21027870-21027892 TTGGGGGGTGGGAGAGTTGTGGG + Intergenic
1188440990 X:30215317-30215339 GTGGGGGCTGAGGGAGGTGGGGG + Intergenic
1189239819 X:39516518-39516540 CGGGGCAGTGAGGGAGATGGGGG - Intergenic
1189879045 X:45470555-45470577 GTGGCTGCTGAGGGAGATGTGGG - Intergenic
1190395665 X:49979271-49979293 GTGGGGAGTGTGGGAGAGGTGGG - Intronic
1190715235 X:53097256-53097278 CTGGGTGGTGAGGGTGAGGGTGG + Intergenic
1190875751 X:54459062-54459084 CCTTGGGGTGGGGGAGATGTAGG - Intronic
1192210274 X:69123471-69123493 CTGTGGGGTGAGGAAAAGGTGGG - Intergenic
1192227997 X:69242592-69242614 CTGGGGGTAGGGGGAGCTGTAGG - Intergenic
1192343367 X:70281737-70281759 GTGGAGGCTGAGGGAGATGAGGG + Exonic
1192504664 X:71674133-71674155 GTGAGGGGTGAGGGAGAGGTGGG + Intergenic
1192547867 X:72028558-72028580 CTGAGGGGTGAGGGAAAGGGAGG - Intergenic
1192577683 X:72255818-72255840 CTGGGGTTTCAGGGAGAGGTGGG + Intronic
1193021002 X:76793317-76793339 TTGGGAGGTTGGGGAGATGTTGG - Intergenic
1193706443 X:84825462-84825484 CTGGGGGGATAAGGAGTTGTGGG + Intergenic
1194842094 X:98754887-98754909 CTGGGGGATGAGGGAAGCGTGGG + Intergenic
1194935207 X:99939803-99939825 CTTGGGGGTGGGGCAGAGGTGGG - Intergenic
1195174918 X:102305866-102305888 GTGGGGGGTGCGGGAGGTGCGGG + Intergenic
1195183947 X:102381227-102381249 GTGGGGGGTGCGGGAGGTGCGGG - Intronic
1195238365 X:102925352-102925374 CGGGGAGGTGAGGGAGAGGTGGG - Intergenic
1196018247 X:110962303-110962325 GTGGAAGGTGAGGGAGATGAAGG - Intronic
1196164517 X:112523957-112523979 CTGGGGGCTGGGGAAGATATTGG - Intergenic
1196483913 X:116181919-116181941 CTGGGGTGTGGAGGAGATATGGG + Intergenic
1196743792 X:119049776-119049798 CTGGGGGTAGGGGGAGATGGTGG + Intergenic
1197711773 X:129676727-129676749 GTGGAGGGGGAGGGGGATGTTGG - Intergenic
1197718425 X:129727304-129727326 CTGGGTGGACAGGGACATGTTGG + Intergenic
1197720856 X:129743736-129743758 CTGGGTGGAGATGGAGGTGTTGG - Intronic
1197876050 X:131108364-131108386 GTGGGGGTTGGGGGAGAGGTAGG - Intergenic
1198703169 X:139418628-139418650 CTGGGGACTGAGAGAGAGGTTGG + Intergenic
1198786969 X:140299341-140299363 AACGGGGGTGAGGGAGAGGTTGG + Intergenic
1200252241 X:154559804-154559826 CTGGAGGTTAAGGGAGCTGTAGG + Intronic
1200265527 X:154644612-154644634 CTGGAGGTTAAGGGAGCTGTAGG - Intergenic
1201194234 Y:11475973-11475995 CTGAGAGGTGAGGGAGCTGGGGG - Intergenic
1201392213 Y:13510951-13510973 CAGGAGGTTGTGGGAGATGTTGG + Intergenic