ID: 1052975730

View in Genome Browser
Species Human (GRCh38)
Location 9:34408571-34408593
Sequence TTGGAAAAGGCTTCCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052975725_1052975730 27 Left 1052975725 9:34408521-34408543 CCTTCACTTTTTTGGTAGCATTC 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1052975730 9:34408571-34408593 TTGGAAAAGGCTTCCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052975730 Original CRISPR TTGGAAAAGGCTTCCTCCCT TGG Intronic
No off target data available for this crispr