ID: 1052976472

View in Genome Browser
Species Human (GRCh38)
Location 9:34414377-34414399
Sequence GGCCAATTGCCTGGCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052976472_1052976482 23 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976482 9:34414423-34414445 TATTAAGATCCTTAGGGGATAGG No data
1052976472_1052976479 16 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976479 9:34414416-34414438 TGGGACATATTAAGATCCTTAGG No data
1052976472_1052976481 18 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976481 9:34414418-34414440 GGACATATTAAGATCCTTAGGGG No data
1052976472_1052976475 -4 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976475 9:34414396-34414418 GGCCAGGACTTATGTCCTTTTGG No data
1052976472_1052976480 17 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976480 9:34414417-34414439 GGGACATATTAAGATCCTTAGGG No data
1052976472_1052976476 -3 Left 1052976472 9:34414377-34414399 CCTGCAGAGCCAGGCAATTGGCC 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1052976476 9:34414397-34414419 GCCAGGACTTATGTCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052976472 Original CRISPR GGCCAATTGCCTGGCTCTGC AGG (reversed) Intronic
900357451 1:2271660-2271682 GGCCCCTTGCCTGTCCCTGCGGG + Intronic
900574050 1:3374268-3374290 GTGCCGTTGCCTGGCTCTGCTGG - Intronic
900622796 1:3595093-3595115 GTCCACTTTGCTGGCTCTGCCGG - Intronic
901084498 1:6602391-6602413 GGCCAACTGCCTGGACATGCAGG - Exonic
901494788 1:9614750-9614772 GGCCTGTTCCCTGGCTCTGGGGG - Exonic
901636764 1:10674175-10674197 GGCCAATGCCCTGACTCTGTAGG - Intronic
902360718 1:15941357-15941379 GGCCACTGCCCTGGCTCTGATGG - Intergenic
904606639 1:31701510-31701532 GGCAACTTGCCTGGCCTTGCTGG - Intronic
904832204 1:33312388-33312410 GGCAGAGTGCCTGGCTCTGCTGG + Intronic
905247256 1:36623778-36623800 GGGAAATTGCCTGGGTTTGCTGG + Intergenic
906209704 1:44005807-44005829 GGCCATTTCCCTGGATCTCCAGG + Intronic
907515056 1:54988523-54988545 GGCCAGGTGCTGGGCTCTGCAGG - Intronic
907916032 1:58870740-58870762 GGCCATTTGGCTGGGGCTGCTGG + Intergenic
911046837 1:93635734-93635756 GGCCGATTGGCTGGCTCTGCAGG - Intronic
912444137 1:109721612-109721634 GGCCAACTCCCTGGCCCTCCCGG - Intronic
914224276 1:145707544-145707566 GCCCACCTGCCTGGCCCTGCGGG + Intronic
915331944 1:155118067-155118089 CCCCACTTGCCTGGCTCTCCTGG - Intergenic
915493581 1:156265771-156265793 GTCCAAATACCTGGCTCTGAAGG + Exonic
915834098 1:159160655-159160677 TGCCAGTTTCCTGGTTCTGCTGG - Intergenic
917982719 1:180281637-180281659 GCCCCTTTGCCTGGCTGTGCAGG + Intronic
920325157 1:205157302-205157324 GGACAAGTCCCTGGCTGTGCAGG + Exonic
920506141 1:206516889-206516911 GGCCAAGTTCCTTGCCCTGCTGG - Intronic
920534676 1:206729795-206729817 GGGCAGGTGCCTGCCTCTGCAGG - Intronic
921010333 1:211134279-211134301 CGCCACTTCCCTGCCTCTGCGGG - Intergenic
1063663958 10:8050975-8050997 CGCCGGTTGCCTGGCTCTGGTGG + Intergenic
1065360432 10:24884521-24884543 CTCCTCTTGCCTGGCTCTGCGGG - Intronic
1065902074 10:30217220-30217242 GGCCATTGGCCTGGCTCTCCTGG + Intergenic
1066993508 10:42539658-42539680 AGCCAGTGGCCTGGCTCGGCAGG - Intergenic
1072439308 10:95439692-95439714 AGCCAAGTCCCTGGCTTTGCAGG + Intronic
1073300843 10:102470256-102470278 GTACACTTGCCTGGCTCGGCAGG + Intronic
1073381785 10:103083476-103083498 ACCCACTTGCCTGGCTTTGCTGG + Exonic
1074117246 10:110465669-110465691 GGCCTCATGCCTGGCTCTGCTGG - Intergenic
1074148529 10:110738468-110738490 GACCAACTGCCTGACTTTGCTGG - Intronic
1074592065 10:114822300-114822322 GGCCTCGGGCCTGGCTCTGCGGG + Intronic
1076594833 10:131619024-131619046 GGCCGATGGCCTGGGGCTGCTGG - Intergenic
1076885454 10:133260131-133260153 GGACCCATGCCTGGCTCTGCAGG - Intergenic
1078210463 11:9265598-9265620 GGCCAAATGCCCGGCTCTGCAGG - Intergenic
1078328714 11:10401398-10401420 GGCAAAGTGCCAGGCTCAGCAGG + Intronic
1081650271 11:44819003-44819025 GGCCATTTGCCTGTCTCCCCAGG + Intronic
1083331277 11:61899475-61899497 GGAGCACTGCCTGGCTCTGCAGG - Intronic
1083333900 11:61911991-61912013 GGCCACTGGCCAGGCCCTGCTGG - Intronic
1084278169 11:68067102-68067124 AGCCATCAGCCTGGCTCTGCAGG + Intronic
1084914955 11:72421690-72421712 GGCCAACTGCCTGCCTCTGCAGG + Intronic
1090966187 11:131599379-131599401 GGCCATGTGACTAGCTCTGCCGG - Intronic
1092029665 12:5273812-5273834 GGCCAAGTGCCTGCCACTGCCGG - Intergenic
1092117605 12:6020545-6020567 GCCAAATTTCCAGGCTCTGCTGG + Intronic
1092284282 12:7119986-7120008 ACCCAATGGCCTGGCTATGCTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094411151 12:30169971-30169993 GGCCCAGCGCCTCGCTCTGCTGG - Intergenic
1102079998 12:110090342-110090364 AGCCAATAGTCTGGCTCTCCTGG - Intergenic
1103408482 12:120693216-120693238 GGCAGATTGCCTTGCCCTGCAGG + Intronic
1104502534 12:129300255-129300277 GGCAACTTGCCTTGCTTTGCAGG - Intronic
1104951207 12:132441326-132441348 TGCAGATTCCCTGGCTCTGCCGG + Intergenic
1107586187 13:41850596-41850618 GGCCTGGTGCCTGACTCTGCAGG - Intronic
1112435087 13:99386138-99386160 GGCTAACTGCCTGGCCCTCCTGG + Intronic
1115627351 14:35207152-35207174 GGCCATTTACCTGGCGATGCCGG + Intronic
1116919834 14:50560743-50560765 CGCCAACTCGCTGGCTCTGCAGG + Intronic
1117570421 14:57043057-57043079 GCCCAATTCCCTGCCTCTTCAGG - Intergenic
1117759355 14:59010357-59010379 GGCCCAGTGCCTGGGTCAGCAGG - Intergenic
1118989957 14:70789055-70789077 GGCCAGTTTTATGGCTCTGCTGG - Intronic
1119471917 14:74905819-74905841 GTCCACGTGCCTGGCTCTGAAGG - Exonic
1121690566 14:95875268-95875290 GGCAAATTGCCCAGGTCTGCTGG - Intergenic
1122399957 14:101461106-101461128 GTCCTATTGCCTGGCTCTGTAGG - Intergenic
1124685132 15:31776197-31776219 GGCCATTTGCCAGGCCCTACTGG - Intronic
1125688526 15:41578298-41578320 GGCCATTTGGCCGGCTCTGGTGG + Exonic
1126435830 15:48636621-48636643 AGCCACTTGTCTGGCTCTGCTGG - Intronic
1126732045 15:51693771-51693793 GGCCACTCTGCTGGCTCTGCAGG + Intronic
1128847476 15:70913417-70913439 TGGGAATTGTCTGGCTCTGCAGG + Intronic
1129290632 15:74564435-74564457 GGCCAGATCCATGGCTCTGCAGG - Intronic
1129530150 15:76258942-76258964 GGCAATTTGGCTGGCTCTGATGG - Intronic
1134431269 16:14209140-14209162 GGCCACGTGCCTGCGTCTGCAGG + Intronic
1135426010 16:22336194-22336216 GGCCAGTTGATTGGGTCTGCAGG - Intergenic
1137264275 16:46855950-46855972 GGCCAATGTCATGACTCTGCTGG - Intergenic
1141428798 16:83960452-83960474 GGCCATTTCCCTGGCACTGGAGG - Intronic
1141729087 16:85809841-85809863 GACCCTTTGCCTGGCTCTGGTGG + Intergenic
1141937926 16:87254448-87254470 CGACACTTGCCTGGCTTTGCAGG - Intronic
1142810987 17:2395380-2395402 GGCCAATAGCCTGGCCAGGCTGG - Exonic
1147628950 17:41918101-41918123 GGCCCATTGCCAGGCTCGACAGG + Intronic
1151114330 17:71716923-71716945 TGCCAATAGCCTGTCTCTCCTGG - Intergenic
1152185870 17:78856007-78856029 GGCCAGCTGCCTGCCCCTGCAGG - Intronic
1152461543 17:80444704-80444726 GGCCAAAGGCCAGGCTCTGGGGG + Intergenic
1153413560 18:4820950-4820972 GGTCAAGTGCCTGGCTCTCTTGG - Intergenic
1153997253 18:10453941-10453963 GGCCCAGTGCCTGGCTCCTCTGG - Intergenic
1154000388 18:10477654-10477676 GGCCAATTTCCTGCTTTTGCAGG - Intronic
1154177029 18:12092509-12092531 CCCCAAGTGCCTGGATCTGCTGG - Intergenic
1157604082 18:48914802-48914824 GGACAATTTCCTGGCTGGGCTGG - Intergenic
1157824605 18:50801443-50801465 GGGCAATTGGCTGCCTTTGCCGG - Exonic
1158920657 18:62187641-62187663 GGCCTAGATCCTGGCTCTGCGGG + Exonic
1160282306 18:77502795-77502817 GGCCCATTCCCTGTCTCTGTAGG + Intergenic
1161507516 19:4651884-4651906 CACCAAGAGCCTGGCTCTGCAGG + Exonic
1162005804 19:7778184-7778206 AGCCTATTGATTGGCTCTGCAGG - Intergenic
1163368634 19:16889742-16889764 GGCCAATGGGCTGGCGCTGTGGG + Exonic
1163371524 19:16903836-16903858 GGACACCTGCGTGGCTCTGCAGG - Exonic
1163822406 19:19503388-19503410 GCCCAGGTGCCAGGCTCTGCAGG + Intronic
1164617494 19:29675735-29675757 AGCCATTTGTGTGGCTCTGCCGG + Intergenic
1164684065 19:30155696-30155718 GCCCCACTGCCTGGCTCAGCAGG - Intergenic
1164736235 19:30543506-30543528 GGCCCAATGCCTGGCTCTTTTGG + Intronic
1166351609 19:42201477-42201499 GGCCAATTGCCTGACCCTTGGGG + Intronic
1166822942 19:45591746-45591768 CACCAACTGCCTGGCTCTGTGGG - Exonic
1168148502 19:54432528-54432550 GGGCAACTGCCTGGCTGTGGGGG - Intronic
925922770 2:8648279-8648301 GGCCTACTGCCTCGCTGTGCAGG - Intergenic
927869103 2:26612594-26612616 TGCCAACTGCCTGGCCCTGCTGG + Intronic
933960779 2:87406899-87406921 GGCTGGTTGGCTGGCTCTGCTGG - Intergenic
933963532 2:87419274-87419296 GGCTGGTTGGCTGGCTCTGCTGG - Intergenic
933964771 2:87425020-87425042 GGCTGGTTGGCTGGCTCTGCTGG - Intergenic
933964884 2:87425529-87425551 GGCTGGTTGGCTGGCTCTGCTGG - Intergenic
934557483 2:95295019-95295041 GGACAACTGCCCTGCTCTGCTGG - Intergenic
934737147 2:96695382-96695404 GCCCCATTCCCTGGCCCTGCAGG + Intergenic
935537090 2:104307615-104307637 GGTCAATGGCCTGGCTCTAACGG + Intergenic
935853564 2:107249288-107249310 GGTCAATGGCCTGTCTCTGGAGG + Intergenic
936068885 2:109352447-109352469 TGCCCATCGCCTGGCTCTGCTGG - Intronic
937052572 2:118904499-118904521 GGCCAAATTTCTGTCTCTGCTGG - Intergenic
937459044 2:122069798-122069820 GGCGAATGGCCTGGCTGGGCTGG - Intergenic
940218815 2:151329169-151329191 GGTCAGTTGCCTGGCTGTGCAGG - Intergenic
941221460 2:162787113-162787135 GGCCTACTGCTTGGGTCTGCAGG - Intronic
943126758 2:183803888-183803910 GGCCTTTTGCCTGGGGCTGCAGG + Intergenic
944927783 2:204482614-204482636 AGCCAATTGCCTGGTGCTGAAGG - Intergenic
946561876 2:220922950-220922972 GGCCAATTGCCAGGGTCCCCAGG - Intergenic
948979078 2:241483605-241483627 GGCCAATGGGCTGCCGCTGCAGG - Intronic
949045577 2:241871318-241871340 TGCCACCTGCGTGGCTCTGCTGG - Intronic
1170153567 20:13249657-13249679 GGCCAACTGGCAGGCTCTGGTGG + Intronic
1171313470 20:24165694-24165716 AGCCAATTGGCTGGACCTGCAGG - Intergenic
1171322494 20:24258647-24258669 GAACAAATGCCAGGCTCTGCTGG - Intergenic
1173029957 20:39347724-39347746 GGCCTGGTGCCTGGGTCTGCAGG - Intergenic
1174386098 20:50189456-50189478 GACCACTTGCCCGCCTCTGCTGG - Intergenic
1175675772 20:60945601-60945623 GGGCAGTGGCCTGGGTCTGCAGG - Intergenic
1175689680 20:61056495-61056517 GGCCCATTTCCAGGCTCTGCAGG - Intergenic
1175862865 20:62159491-62159513 CGCCCACTGCCTGGCTCAGCTGG + Intronic
1176059200 20:63164928-63164950 GGCCCCGTGCCTGGCTCTGGGGG + Intergenic
1179030780 21:37717933-37717955 GGACAATTGCCTGGAGCTGGGGG - Intronic
1181781853 22:25199624-25199646 TGCCCCTTGCCTGGCGCTGCTGG + Intergenic
1182145985 22:27996996-27997018 GGCCCCTTTCCTGTCTCTGCAGG - Intronic
1184231393 22:43160105-43160127 GGCCAGGTGCCCGGCTCTGATGG + Intronic
1184913240 22:47550036-47550058 GGCCAAGTGCCTGCCTCTGTAGG - Intergenic
1185166912 22:49266973-49266995 AGCCAAGTGGCTGGGTCTGCCGG + Intergenic
1185332862 22:50259438-50259460 GGCCACGTGCCTTGCTCAGCGGG - Intronic
949612881 3:5720934-5720956 GGGTAATTGCCTTACTCTGCTGG + Intergenic
954882359 3:53844781-53844803 GGCCACCTGGTTGGCTCTGCAGG - Intronic
956028350 3:65008325-65008347 TGACCATTGCCTGTCTCTGCAGG + Intergenic
958149785 3:89675856-89675878 GGGAGATTGCCAGGCTCTGCTGG + Intergenic
958804123 3:98788827-98788849 GGCCAAGTGCATGGCTTTGCAGG + Intronic
961125816 3:124416596-124416618 GGCTGAATGCCTGGTTCTGCAGG + Intronic
962530786 3:136277891-136277913 AGCCAGGTGCCTGGCCCTGCAGG - Intronic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
966246815 3:177817905-177817927 GGCCTGGTGCCTGACTCTGCAGG + Intergenic
968300144 3:197606660-197606682 GGCCCATTCGCTGGCTCTGCAGG + Intergenic
969429861 4:7147792-7147814 GGTCTGTAGCCTGGCTCTGCAGG + Intergenic
971035929 4:22692937-22692959 GCACAATTGCCTGGCTCCTCTGG + Intergenic
977848160 4:101790887-101790909 AGCCCCTTGCCTGGCGCTGCTGG - Exonic
983249387 4:165327479-165327501 CGACCATTGGCTGGCTCTGCAGG + Intergenic
984648018 4:182240624-182240646 GGAGAATTGCCAGGCTCTGATGG - Intronic
987429533 5:17815626-17815648 TTACAATTGCCTGGCTCTCCAGG + Intergenic
989443105 5:41495139-41495161 TCCCAATTGCATGACTCTGCTGG - Intronic
992542465 5:77778470-77778492 GGCCCATTCCCAGGCTCTGGAGG + Intronic
997630561 5:135365370-135365392 GGCCAAATACCTTACTCTGCTGG + Intronic
998168041 5:139855716-139855738 GGGCATCTGCGTGGCTCTGCTGG - Exonic
999605871 5:153315255-153315277 GGCAAGTTGCCCAGCTCTGCTGG - Intergenic
1002167613 5:177358142-177358164 GGGCTCTTGCCTGGCCCTGCCGG - Intronic
1002874817 6:1201580-1201602 GGCCAGAAGCCTGGCTCTCCAGG + Intergenic
1002874852 6:1201736-1201758 GGCCAGAAGCCTGGCTCTCCTGG + Intergenic
1006627631 6:35408652-35408674 AGCCGATTGCTTGGCTCTGGGGG + Intronic
1013465780 6:110415847-110415869 AGCCGGGTGCCTGGCTCTGCTGG + Intergenic
1014379318 6:120719795-120719817 GGCAAATAGCTTGGCACTGCTGG - Intergenic
1016295268 6:142566715-142566737 GGCCAAATGCATGTGTCTGCAGG + Intergenic
1019095286 6:169574819-169574841 GGCCAATAGCTTATCTCTGCAGG + Intronic
1027503230 7:78981915-78981937 TGACAATTCCCTGGCTCAGCAGG + Intronic
1035518240 8:255048-255070 GGCCAATTGCCTACCACTGTAGG + Intergenic
1037971330 8:23173985-23174007 GGCCAGTGGGCTGGCACTGCTGG + Intergenic
1038537406 8:28363367-28363389 GGCCATCTGCCTGCCTCAGCAGG + Intronic
1046271730 8:111904925-111904947 GGCATATTGCCTGGATCTACTGG + Intergenic
1048108884 8:131444172-131444194 TGTCAATTGCCTAGCACTGCCGG + Intergenic
1048986955 8:139739849-139739871 TGCCATTTGCCTGCCTGTGCTGG - Intronic
1050097622 9:2083730-2083752 GGGTAATTGCCTGACTTTGCAGG - Intronic
1052228854 9:26122801-26122823 GGCCAATTCCCTGGCCGTTCTGG - Intergenic
1052976472 9:34414377-34414399 GGCCAATTGCCTGGCTCTGCAGG - Intronic
1055478056 9:76683132-76683154 GGTCAGTTGCCTGTCTCTGACGG - Intronic
1055667182 9:78564287-78564309 GCCAACTTTCCTGGCTCTGCTGG - Intergenic
1058884242 9:109311406-109311428 TGCCAACTGCCTGGTTCAGCGGG - Intronic
1060532035 9:124353395-124353417 GGCCATTGGCCTGGCCCTTCAGG - Intergenic
1188058703 X:25573688-25573710 GGCCCAGAGCCTGACTCTGCAGG + Intergenic
1190319557 X:49172167-49172189 GGCCAAGTGCCTGCCTCACCCGG - Intronic
1191112941 X:56821915-56821937 GGCCTAGAGCCTGGGTCTGCAGG - Intergenic
1192184080 X:68934709-68934731 GGCCCATTGCCTTGCTAGGCCGG + Intergenic
1195379463 X:104256789-104256811 GGCAAGTTGCCTGGCTCTTTGGG - Intergenic
1198275217 X:135093503-135093525 GCCCAATTCCCTGCCTCTCCAGG + Intergenic