ID: 1052978695

View in Genome Browser
Species Human (GRCh38)
Location 9:34431111-34431133
Sequence CTGCAGCCATAGAGAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 542}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052978695_1052978702 24 Left 1052978695 9:34431111-34431133 CCAATCTCTCTCTATGGCTGCAG 0: 1
1: 0
2: 1
3: 49
4: 542
Right 1052978702 9:34431158-34431180 GCTGCCTGGCCAGATTTTCAAGG No data
1052978695_1052978704 26 Left 1052978695 9:34431111-34431133 CCAATCTCTCTCTATGGCTGCAG 0: 1
1: 0
2: 1
3: 49
4: 542
Right 1052978704 9:34431160-34431182 TGCCTGGCCAGATTTTCAAGGGG No data
1052978695_1052978699 10 Left 1052978695 9:34431111-34431133 CCAATCTCTCTCTATGGCTGCAG 0: 1
1: 0
2: 1
3: 49
4: 542
Right 1052978699 9:34431144-34431166 ATGCCAGCAGCCTAGCTGCCTGG No data
1052978695_1052978703 25 Left 1052978695 9:34431111-34431133 CCAATCTCTCTCTATGGCTGCAG 0: 1
1: 0
2: 1
3: 49
4: 542
Right 1052978703 9:34431159-34431181 CTGCCTGGCCAGATTTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052978695 Original CRISPR CTGCAGCCATAGAGAGAGAT TGG (reversed) Intronic
900425054 1:2573993-2574015 CTTCAGCCATTGAGAGAGAGTGG + Intergenic
901640484 1:10690634-10690656 CTGCAGCCACAGCGACACATGGG + Intronic
901868445 1:12123391-12123413 CAGCAGCCAAACAGAGAGAAGGG - Intronic
902460359 1:16570684-16570706 GTGCAGCCAGAGAGAAAGGTCGG + Intronic
904595631 1:31643481-31643503 TTGCATCCTTAGAGAGAGGTAGG - Intronic
905453144 1:38069960-38069982 CAGCAGCCATGGAGCCAGATAGG - Intergenic
905945345 1:41897095-41897117 TTGCAGTCAGGGAGAGAGATTGG + Intronic
906739787 1:48171731-48171753 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
908833336 1:68203722-68203744 TTGCAGGCATAGTGAGAGACAGG + Intronic
909602208 1:77472544-77472566 CTGCATCCAAAAAGAGAGGTGGG + Intronic
910068589 1:83183773-83183795 CGGCAGCCAGAGAGAAAGGTTGG + Intergenic
910177387 1:84444810-84444832 GGGCAGCCAGAGAGAGAGGTCGG + Intergenic
910214041 1:84824257-84824279 ATGCTGCCTTACAGAGAGATGGG + Intronic
910381178 1:86628744-86628766 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
910591373 1:88930720-88930742 ATGCAGCAATATAGAGAGAAAGG + Intergenic
911270836 1:95798963-95798985 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
912303764 1:108543597-108543619 GGGCAGCCAGAGAGAGAGGTCGG + Intergenic
912828161 1:112925199-112925221 CTCCAGCCACAGAGGGAGACTGG - Intronic
913081070 1:115387722-115387744 TTGCAGCCAGAGAGAAAGGTCGG - Intergenic
914996937 1:152552195-152552217 GTGCAGCCAGAGAGAAAGGTCGG - Intronic
915011672 1:152692625-152692647 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
915688629 1:157663361-157663383 GCGCAGCCAGAGAGAAAGATTGG + Intergenic
915711517 1:157903561-157903583 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
917308637 1:173654501-173654523 GTGCAGCCAGAGAGAAAGGTTGG - Intronic
917842373 1:178992002-178992024 GGGCAGCCAGAGAGAGAGGTCGG - Intergenic
918167076 1:181960459-181960481 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
918195852 1:182220511-182220533 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
918541729 1:185639639-185639661 GGGCAGCCATAGAGAAAGGTCGG + Intergenic
918592988 1:186261002-186261024 GGGCAGCCATAGAGAAAGGTCGG - Intergenic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
918826344 1:189329672-189329694 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
919055027 1:192559877-192559899 CTGAAGAGAGAGAGAGAGATGGG + Intergenic
919291786 1:195642750-195642772 CAGCAGGCAAAGAGAGAGAGAGG + Intergenic
920706103 1:208251717-208251739 CTGCAGCCCCAGAGAGAAAGAGG - Intergenic
920752656 1:208694611-208694633 GTGCAGCCATACAAAGAAATAGG + Intergenic
920972501 1:210754609-210754631 CAGGAGCAATAGAGAGAGTTGGG - Intronic
921042964 1:211451633-211451655 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
921115161 1:212083206-212083228 CGGCAGGCAAAGAGAGAGATTGG + Intronic
921504618 1:215952784-215952806 GGGCAGCCATAGAGAAAGGTCGG - Intronic
922200824 1:223399938-223399960 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
922684352 1:227627611-227627633 ATGCAGCAATATAGAGAGAAAGG - Intronic
923194309 1:231650466-231650488 GTGCAGCCAGAGAGAAAGGTCGG - Intronic
923640164 1:235749431-235749453 CTTCAGAGAGAGAGAGAGATGGG + Intronic
924639319 1:245818134-245818156 GGGCAGCCAGAGAGAAAGATCGG + Intronic
924868352 1:248011354-248011376 CAGCAGCCAGAGAGAAAGACTGG - Intronic
924900719 1:248396007-248396029 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1065463536 10:25994914-25994936 GGGCAGCCAGAGAGAAAGATCGG - Intronic
1065985678 10:30948987-30949009 CGGCAGCCAGAGAGAAAGGTCGG + Intronic
1067703576 10:48590571-48590593 CTGCAGCAATATAGAGGCATGGG - Intronic
1068256386 10:54516797-54516819 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1068821082 10:61377780-61377802 GGGCAGCCAGAGAGAGAGGTTGG - Intergenic
1069093095 10:64225768-64225790 TTGCAGCTAAAGAGAAAGATGGG + Intergenic
1069213474 10:65790815-65790837 CTGCAGGCAAAGAGAGAGCTTGG - Intergenic
1069539215 10:69280989-69281011 CTGCAGCTATACAGAGACATAGG - Intronic
1069541233 10:69295617-69295639 CTGTAGCCTTAGAGAAAGACAGG - Exonic
1070405116 10:76087569-76087591 GTGTAGCTGTAGAGAGAGATGGG + Intronic
1071305923 10:84298715-84298737 CTGGAGTCATAGAAAGGGATGGG + Intergenic
1072344481 10:94489761-94489783 CTGAAGAGATAGAGAGAGATGGG + Intronic
1072351968 10:94565855-94565877 CTGCATACAGAGAGAGATATAGG + Intronic
1073520768 10:104127023-104127045 CTGCAGTCACAAAAAGAGATGGG - Intergenic
1073615113 10:104986713-104986735 CTGAAGACAGGGAGAGAGATAGG + Intronic
1073966268 10:108993949-108993971 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1074226656 10:111490986-111491008 TTGTAGCTAAAGAGAGAGATAGG - Intergenic
1075996810 10:126883467-126883489 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1076419360 10:130318776-130318798 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1077293553 11:1812954-1812976 GTGGAGCCTTAGAGAGAGAATGG - Intergenic
1077655506 11:4015448-4015470 GGGCAGCCAGAGAGAGAGGTCGG - Intronic
1077979871 11:7288834-7288856 GAGCAGCCATAGAGAGAGCAGGG - Intronic
1078796648 11:14599142-14599164 GTGCAGCCAGAGAGAAAGGTTGG - Intronic
1078817998 11:14846077-14846099 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1080082399 11:28237006-28237028 GGGCAGCCACAGAGAAAGATCGG - Intronic
1080520054 11:33060818-33060840 CTCCAGCTCTAGAGACAGATAGG - Intronic
1080977323 11:37358298-37358320 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
1081082402 11:38758350-38758372 ATGGAGCCAAAGAGAGAGAGAGG + Intergenic
1081317565 11:41649489-41649511 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1082924801 11:58533262-58533284 GTGCAGCCAAAGAGAAAGGTTGG + Intronic
1083543772 11:63534132-63534154 TTGCAGCAAGAGAGAGAGATGGG + Intergenic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1084330030 11:68424766-68424788 GTGCAGCCAGACAGAGAGACTGG - Intronic
1085683613 11:78601848-78601870 CAGCAGCCAGAGAGAAAGGTCGG - Intergenic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086349049 11:85926325-85926347 CGGCAGCCAGAGAGATAGGTCGG + Intergenic
1086642344 11:89175337-89175359 TTGCAGACATGGGGAGAGATGGG - Intergenic
1087703611 11:101465192-101465214 GGGCAGCCAGAGAGAAAGATTGG - Intronic
1088526023 11:110756050-110756072 CTACAGCCTTAGAGAGATTTAGG - Intergenic
1089625699 11:119749341-119749363 CTGCATCCTTGGAGACAGATGGG + Intergenic
1090821401 11:130345562-130345584 CTTCAGTCATAGAGAGACACAGG - Intergenic
1091302469 11:134516187-134516209 CTCCAGCCGTACAGAGAGACTGG + Intergenic
1091424452 12:374980-375002 GGGCAGCCAGAGAGAAAGATCGG - Intronic
1093718766 12:22413870-22413892 CTGCAGCCAGGGAGAGAGAAAGG + Intronic
1094299459 12:28945959-28945981 CTGCAGAGAGAGAGAGAGAGAGG + Intergenic
1094483198 12:30901352-30901374 CAGCAGGCAAAGAGAGAGTTTGG - Intergenic
1095059411 12:37664994-37665016 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1095146548 12:38735749-38735771 CTGCAGATTTAGACAGAGATTGG - Intronic
1095218015 12:39572777-39572799 CTGCAGCCAGAAAGAGAGAGAGG + Intronic
1095429071 12:42112868-42112890 GTGCAGCCAGAGAGAAAGGTCGG + Intronic
1095845421 12:46738712-46738734 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1096597695 12:52707259-52707281 GTGCAGCCGGAGAGAGAGGTGGG - Intergenic
1096865099 12:54557935-54557957 CTTCAGCCCTTGAGAGAGAGAGG - Intronic
1096891777 12:54778470-54778492 CAGCAGCCAGAGAGAAAGGTTGG + Intergenic
1097452494 12:59752842-59752864 GGGCAGCCAGAGAGAAAGATCGG + Intronic
1097517338 12:60621478-60621500 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
1098151682 12:67554104-67554126 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1098316739 12:69201028-69201050 CAGGTGCCATAGAGACAGATAGG + Intergenic
1099357867 12:81660784-81660806 GTGCAGCCAGAGAGAAAGGTCGG + Intronic
1099431083 12:82586885-82586907 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1099514948 12:83585814-83585836 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
1099897708 12:88669191-88669213 GAGCAGCCAGAGAGAAAGATTGG + Intergenic
1100067346 12:90665087-90665109 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1101416081 12:104509220-104509242 CAGCAGGCAAAGAGAGAGATTGG - Intronic
1102528810 12:113531256-113531278 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1102671934 12:114627244-114627266 CTGTAGGTATATAGAGAGATAGG - Intergenic
1104342716 12:127966570-127966592 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1104342990 12:127968469-127968491 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1104403366 12:128496237-128496259 GTGCAGCCAAAGAGAAAGGTCGG - Intronic
1105239811 13:18599043-18599065 CTGGTGGCATAGACAGAGATGGG + Intergenic
1105378376 13:19864284-19864306 CTGCAGCCATGGCGGGAGGTGGG - Intergenic
1105388838 13:19958064-19958086 CTGCAGCCATGGCGGGAGGTGGG + Intergenic
1105645618 13:22314843-22314865 CGGCAGCCAGAGAGAAAGGTCGG - Intergenic
1105698415 13:22914518-22914540 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1105850075 13:24326757-24326779 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1106124100 13:26885996-26886018 CAGCAGACAAAGAGAGAGATTGG + Intergenic
1106980365 13:35272093-35272115 CGGCAGCCAGAGAGAAAGGTTGG + Intronic
1107491949 13:40888692-40888714 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1108286717 13:48916111-48916133 CTGCATTCATTGGGAGAGATAGG - Intergenic
1108291485 13:48966218-48966240 TTGTAGCCAGGGAGAGAGATTGG + Intergenic
1108777587 13:53785093-53785115 CAGGAGCCAGAGAGAGAGAGAGG + Intergenic
1108873004 13:55009593-55009615 AAGCAGCCAGAGAGAAAGATCGG + Intergenic
1109553320 13:63935547-63935569 ATGCAGCCATAAAAAGGGATGGG - Intergenic
1109626481 13:64981505-64981527 CAGCAGCCAGAGAGAAAGGTTGG - Intergenic
1109833770 13:67828153-67828175 AGGCAGCCATAGAGAGATAATGG + Intergenic
1110231223 13:73169448-73169470 CTGAAGCATGAGAGAGAGATGGG + Intergenic
1110606786 13:77442239-77442261 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1110809651 13:79797717-79797739 CTGCAGTCAAAAACAGAGATAGG - Intergenic
1112284577 13:98093095-98093117 TGGCAGGCAAAGAGAGAGATTGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1112635555 13:101213801-101213823 CTGGAGGCATATAGAGAAATAGG + Intronic
1113491540 13:110696108-110696130 GTGCAGCCATAGAAAAGGATGGG - Intronic
1113800471 13:113083695-113083717 CCGCAGGCAAAGACAGAGATGGG - Intronic
1113935171 13:113990074-113990096 CAGGAGCAAGAGAGAGAGATGGG - Intronic
1114872713 14:26677724-26677746 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1115717531 14:36122835-36122857 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1116042426 14:39701989-39702011 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1116592862 14:46802092-46802114 TAGCAGGCAAAGAGAGAGATTGG + Intergenic
1116811089 14:49540838-49540860 CTGCAGCCTTTGAGAGAGTTGGG - Intergenic
1117204328 14:53425499-53425521 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1117238149 14:53799909-53799931 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1117529093 14:56641252-56641274 GGGCAGCCAGAGAGAAAGATGGG + Intronic
1117841117 14:59861296-59861318 CAGCAGGCAAAGAGAGAGATTGG - Intronic
1117883660 14:60336678-60336700 ATGCAGCCATAAAAAGGGATAGG - Intergenic
1117891383 14:60425896-60425918 GGGCAGCCAGAGAGAAAGATCGG - Intronic
1118706938 14:68488731-68488753 TTGCAGCCTTGGAGAGAGATGGG - Intronic
1118740777 14:68737877-68737899 CTGCAGAAATAGCTAGAGATTGG - Intergenic
1118802926 14:69207567-69207589 CTTCAGCCATAGAGAAGTATAGG + Intronic
1119636455 14:76277424-76277446 TTTCAGCGAGAGAGAGAGATTGG - Intergenic
1122417776 14:101558473-101558495 GTGCAGCCCTAGAGAGAGGTAGG + Intergenic
1122443189 14:101748606-101748628 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1122840022 14:104454731-104454753 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1123586834 15:21768645-21768667 ATGCAGCCATAGAAAGGAATGGG + Intergenic
1123623473 15:22211210-22211232 ATGCAGCCATAGAAAGGAATGGG + Intergenic
1124273852 15:28309291-28309313 TTACAGCTAAAGAGAGAGATAGG - Intronic
1124663031 15:31566773-31566795 CTGGAGCAAGAGAGAGAGAGTGG - Intronic
1124856497 15:33394338-33394360 GTACAGCCAAAAAGAGAGATGGG + Intronic
1125354370 15:38801870-38801892 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
1125969649 15:43901564-43901586 CCACAGCCACAGAGAGAGACTGG + Intronic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1126937552 15:53728205-53728227 CAGCAGGCAAAGAGAGATATTGG + Intronic
1127628386 15:60802467-60802489 CTGCAGGGGAAGAGAGAGATGGG - Intronic
1128012722 15:64313412-64313434 ATGCAGCCATAAAAAAAGATGGG + Intronic
1128067159 15:64772529-64772551 GTGCAGCCATAATGAGAGTTTGG - Intronic
1128245842 15:66132218-66132240 CTGCCACCAGAGAGAGAGACTGG - Intronic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1129478870 15:75807347-75807369 ATGCAGCCATACAGAGGGTTAGG - Intergenic
1130084074 15:80762661-80762683 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1130442100 15:83964760-83964782 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1130510221 15:84583027-84583049 ATGCAGCCACAGAGAGGGTTAGG + Intergenic
1130647613 15:85742601-85742623 CAGCAGCTATAGAGAAAGAGAGG - Intronic
1131460783 15:92616214-92616236 CTGAAGCCATTTAAAGAGATTGG - Intergenic
1131526374 15:93155930-93155952 CAGGAGCAAGAGAGAGAGATGGG - Intergenic
1132122670 15:99191549-99191571 CAGCAGGCAAAAAGAGAGATTGG - Intronic
1132792574 16:1700319-1700341 CTGCAGCCCTTGAGGGGGATGGG - Exonic
1133664374 16:7951602-7951624 CTGCTGAGAGAGAGAGAGATTGG - Intergenic
1134012928 16:10868651-10868673 CTGCAGCCAGGGAGAGAGGAAGG - Intergenic
1134515675 16:14885044-14885066 CTGGAGCAAAAGAGAGAGTTGGG + Intronic
1134703348 16:16283688-16283710 CTGGAGCAAAAGAGAGAGTTGGG + Intronic
1134964195 16:18428426-18428448 CTGGAGCAAAAGAGAGAGTTGGG - Intronic
1134968482 16:18510962-18510984 CTGGAGCAAAAGAGAGAGTTGGG - Intronic
1135948297 16:26885779-26885801 CTGCAGCTAGAGATAGAAATAGG + Intergenic
1136933098 16:34436241-34436263 CTGCAGCCCCAGACACAGATGGG + Intergenic
1136971474 16:34975573-34975595 CTGCAGCCCCAGACACAGATGGG - Intergenic
1137067694 16:35865494-35865516 ATGCAGCCATAAAAAGAAATGGG - Intergenic
1137335552 16:47545497-47545519 CAGCAGCCAGAGAGAAAGGTCGG - Intronic
1137680118 16:50334766-50334788 CTGCTGGCAGAGAGAGAGAGAGG - Exonic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1138874928 16:60937658-60937680 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1139632510 16:68239129-68239151 CTGGAGCCCTAGATAGAGAAGGG - Intergenic
1140165428 16:72545274-72545296 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1140855145 16:78971516-78971538 CTACAGCCATGGAAAGAGAATGG + Intronic
1140914801 16:79483721-79483743 TGGCAGGCATAGAGAGAGAGGGG + Intergenic
1141487494 16:84350519-84350541 CTGCAGAGAGAGAGAGAGAGAGG - Intergenic
1141913987 16:87081094-87081116 ATAGAGCCATAGAGAGAGCTAGG - Intergenic
1143327745 17:6110486-6110508 CTGTGGCCATAGAGACAGAATGG + Intronic
1143353344 17:6306121-6306143 GTCCAGCCACAGAGAGAGAGGGG - Intergenic
1144831953 17:18136764-18136786 CTGCAGGCACAGAAAGGGATGGG - Intronic
1146539882 17:33685180-33685202 CTGCTGCCTTAGAGAGGGTTGGG - Intronic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1147948072 17:44091733-44091755 CTGCAGCCCTAGGGAGATGTTGG + Exonic
1149223070 17:54437585-54437607 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1150335348 17:64326631-64326653 CTGCCCCCACAGAGAGAGAGCGG - Intronic
1150932731 17:69602867-69602889 CTGCAGGCATGTACAGAGATGGG - Intergenic
1151140735 17:71989811-71989833 GTACAGCAATAGAGAGAGACAGG - Intergenic
1152594889 17:81233264-81233286 CAGCAGCCAGAGAGAGACAGTGG + Intronic
1152814779 17:82401061-82401083 CTGCAGCCCGAGAGGGAGAGAGG + Intronic
1153279338 18:3399374-3399396 ATGCAGCTATAGATATAGATAGG - Intergenic
1153401884 18:4690873-4690895 ATGCAGCAATAGGGAGAGAAAGG + Intergenic
1153706799 18:7754011-7754033 CTGCACCCATAGAGATGTATGGG - Intronic
1153980349 18:10303428-10303450 CTGCAGAAGTAGAGAGAAATGGG - Intergenic
1154449019 18:14459731-14459753 CTGGTGGCATAGACAGAGATGGG - Intergenic
1155534150 18:26798406-26798428 CTAGAGCTAAAGAGAGAGATAGG + Intergenic
1155740990 18:29287327-29287349 CTTCAGCCATTGAGAGATATGGG - Intergenic
1155775728 18:29758057-29758079 CTTCAGCTATAGAGAGTTATTGG - Intergenic
1155982189 18:32192914-32192936 CTGCACCCTTAGAGATAGTTAGG - Intronic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1156586596 18:38437889-38437911 TTGCCACCACAGAGAGAGATGGG - Intergenic
1157561623 18:48650711-48650733 GGGCAGCCATAGAGAAAGGTCGG + Intronic
1158314989 18:56202170-56202192 CAGTAGCTATAGAGAGAGGTAGG - Intergenic
1158703864 18:59773046-59773068 CGGCAGCCAGAGAGAAAGGTAGG + Intergenic
1159089213 18:63828262-63828284 CAGAAGCAAGAGAGAGAGATGGG - Intergenic
1159312406 18:66726209-66726231 CTGCAGCCAGAAAGAGAAATAGG + Intergenic
1159697221 18:71575255-71575277 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1160015991 18:75141181-75141203 ATGGAGGCAGAGAGAGAGATTGG + Intergenic
1160296152 18:77638833-77638855 ATGCAGCCAGAGAGAAAGGTTGG + Intergenic
1161023244 19:2021675-2021697 CTGCAGCCAGAGAGAGGGGCTGG - Intronic
1161267074 19:3369341-3369363 ATGCAGAGATAGAGAGAGACAGG - Intronic
1163900952 19:20099842-20099864 ATGCAGCAATATAGAGAGAAGGG + Intronic
1164111098 19:22159926-22159948 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1164246463 19:23434536-23434558 GGGCAGCCAGAGAGAGAGGTCGG - Intergenic
1164718811 19:30416205-30416227 TTGCAACCATAAAGAGAGAAAGG - Intronic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166302116 19:41917247-41917269 ATGCACCCAGAGAGAGAGATGGG - Intronic
1167462942 19:49635902-49635924 CCGCAGCCAGAGAGACAGACAGG + Intronic
1202676793 1_KI270711v1_random:14412-14434 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
925334458 2:3084100-3084122 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
925618267 2:5765255-5765277 AGGCAGACAGAGAGAGAGATAGG + Intergenic
928336556 2:30403463-30403485 CTCTAGGGATAGAGAGAGATGGG - Intergenic
928631170 2:33193845-33193867 CTGAAGACAGGGAGAGAGATGGG - Intronic
931069456 2:58628258-58628280 ATGCAGTCATAGAGAAACATTGG - Intergenic
931584008 2:63807378-63807400 TGGGAGCAATAGAGAGAGATGGG - Intronic
932918006 2:75877884-75877906 ATGCAGCAATATAGAGAGATAGG + Intergenic
933124332 2:78585556-78585578 TTGCAGCAAGGGAGAGAGATTGG + Intergenic
933269129 2:80214662-80214684 GGGCAGCCAGAGAGAGAGGTCGG - Intronic
933366560 2:81361364-81361386 GGGCAGCCAAAGAGAAAGATCGG - Intergenic
934989064 2:98908577-98908599 TTGCAGCAATAGAGTGAGTTTGG - Intronic
935418758 2:102845258-102845280 CTGCAGCTATAGACAGACCTGGG + Intergenic
935833576 2:107025526-107025548 CTGGAGCCTTCGAGAGAGATGGG + Intergenic
936229040 2:110683299-110683321 CTGGAGACAGGGAGAGAGATGGG + Intergenic
936501223 2:113067887-113067909 CTGCAGCCAATTATAGAGATTGG + Intergenic
936616462 2:114052884-114052906 CTGCAGAGAAAGAGAGAGAATGG - Intergenic
937304743 2:120864399-120864421 CTTCAGCCATCGAGACACATGGG - Intronic
937549153 2:123065356-123065378 GTGAAGACATAGACAGAGATTGG + Intergenic
939936931 2:148304612-148304634 CTGCAGTGGGAGAGAGAGATTGG + Intronic
940437476 2:153671288-153671310 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
941302783 2:163824971-163824993 TTAGAGCTATAGAGAGAGATAGG - Intergenic
941348855 2:164406347-164406369 CTCAAGCCATACAGAGACATGGG + Intergenic
941881236 2:170482454-170482476 CGGCAGGCAAAGAGAGAGCTTGG - Intronic
941934138 2:170970218-170970240 CTGCAGCCATTGATGGAGGTGGG + Intergenic
942200087 2:173561654-173561676 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
942860840 2:180609950-180609972 TTGGAGCCATAAAGGGAGATGGG - Intergenic
942927859 2:181455776-181455798 CTGCAGCAATAAGTAGAGATAGG - Intergenic
943140638 2:183977159-183977181 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
943159919 2:184234361-184234383 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
943427643 2:187756375-187756397 CTAGAGCTAAAGAGAGAGATAGG - Intergenic
943598972 2:189891636-189891658 GGGCAGCCACAGAGAGAGGTCGG - Intronic
944140357 2:196449484-196449506 CAGCATCCATAGAAAGAAATCGG - Intronic
944164918 2:196708907-196708929 CGGCAGCCAGAGAGAAAGGTCGG - Intronic
945352847 2:208802372-208802394 GGGCAGCCAGAGAGAAAGATCGG + Intronic
945652726 2:212584797-212584819 GGGCAGCCAGAGAGACAGATCGG - Intergenic
946294272 2:218771371-218771393 CGGCAGCCAGAGAGAAAGGTCGG - Intergenic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948904517 2:240972267-240972289 CTGCAGCCACAGGGAGCCATGGG + Intronic
1168921871 20:1545019-1545041 AGGCAGCCAGAGAGAAAGATTGG - Intronic
1169314421 20:4576612-4576634 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1169396872 20:5240144-5240166 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
1171791256 20:29527497-29527519 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
1172573528 20:35988670-35988692 TTGCAGCCAGAGACAGAGATTGG + Intronic
1173098266 20:40059370-40059392 CAGCAGCAAGAGAGAGAGAAAGG - Intergenic
1173484422 20:43429945-43429967 CTGCAGCGAGGGAGAGAGACTGG + Intergenic
1173699925 20:45060617-45060639 CTGGAGGCTTAGAGAGATATAGG - Intronic
1173784399 20:45782245-45782267 CTGCAGGCATTGAGGGAGACGGG - Intronic
1174580583 20:51568683-51568705 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1175964592 20:62654185-62654207 CTGCAGACAGAGACAGAGACGGG - Intronic
1180032747 21:45223587-45223609 CTGGGGCCATGGGGAGAGATTGG + Exonic
1180668478 22:17534086-17534108 CTGCAGTGATTGAGAGAGAATGG + Intronic
1180673861 22:17573647-17573669 CTGCAGGGAAGGAGAGAGATGGG - Intronic
1181311127 22:21945570-21945592 CTGCAGCCTTTGAGAGAGCATGG + Intronic
1181374373 22:22444212-22444234 ATGCAGCCATAAAAAGGGATGGG + Intergenic
1182992531 22:34781872-34781894 GTGCATCCAGAGAGAGAAATGGG - Intergenic
1183601134 22:38841262-38841284 CAGCAGCCACAGACAGAGAAGGG - Intronic
1185062982 22:48616700-48616722 CTGCAGCCCTAGACAGAGGGTGG - Intronic
949201855 3:1389150-1389172 CGGCAGCCAGAGAGAAAGGTCGG + Intronic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950298543 3:11853285-11853307 CTATAGCCTAAGAGAGAGATTGG + Intergenic
950439485 3:13000840-13000862 CTGCAGGAATAGAGATAGTTTGG - Intronic
950781411 3:15395899-15395921 GGGCAGCCAGAGAGAAAGATCGG - Intronic
950924761 3:16729411-16729433 TTGCAGTCAGGGAGAGAGATTGG + Intergenic
951079691 3:18438495-18438517 CTCCAGCCACAGTGACAGATAGG - Intronic
951125375 3:18977659-18977681 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
951591282 3:24267810-24267832 TTGCAGTCAGGGAGAGAGATTGG - Intronic
951805136 3:26635491-26635513 GTGCAGGCAGAGAGAGAGAGAGG - Intronic
951904565 3:27691335-27691357 TTACAGCTAAAGAGAGAGATGGG + Intergenic
952978501 3:38716425-38716447 CAGCAGGCAAAGAGAGAGGTTGG - Intronic
953289348 3:41646597-41646619 GGGCAGCCATAGAGAAAGGTCGG - Intronic
953354147 3:42240221-42240243 GGGCAGCCATAGAGAAAGGTCGG + Intergenic
953401907 3:42630617-42630639 GGCCAGCCATAAAGAGAGATTGG + Intronic
953717290 3:45326412-45326434 CTGCAGCCTTTTAGAGAAATAGG - Intergenic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
954576910 3:51681368-51681390 CTGGAGTGATGGAGAGAGATGGG + Intronic
954794094 3:53152764-53152786 CTGCAGCCACAGAGACCGAGAGG + Intergenic
955350396 3:58189221-58189243 CTCCAGCCCAAGGGAGAGATAGG + Intergenic
955983193 3:64547489-64547511 CTATAGCCAGGGAGAGAGATAGG - Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956471789 3:69574684-69574706 ATGCAGCCATAAAGAAGGATGGG - Intergenic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957116630 3:76035151-76035173 GTCCAGCCATAGAAAAAGATAGG - Intronic
957565576 3:81879848-81879870 GGGCAGCCATAGAGAAAGGTCGG + Intergenic
958948087 3:100387413-100387435 CTCCAGCCTTGGTGAGAGATTGG + Intronic
960763055 3:121095191-121095213 AGGCAGCCAGAGAGAGAGGTCGG - Intronic
960874871 3:122286257-122286279 CTGGAGCCAGAGAGACAGACCGG + Exonic
961746505 3:129067017-129067039 CAGCAGCCACGGAGAGAGAAGGG - Intergenic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
963297476 3:143561583-143561605 CTGTAGCCATGGCGAGAGAATGG - Intronic
963316246 3:143762003-143762025 ATGCAGCCATAAAGAAGGATGGG + Intronic
963338407 3:144003713-144003735 AGGCAGCCATAGAAAGAAATGGG + Intronic
964189681 3:153987796-153987818 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
964782900 3:160360593-160360615 CGGCAGCCAGAAAGAAAGATCGG + Intronic
965127410 3:164648678-164648700 CAGCAGGCAAAGAGAAAGATTGG - Intergenic
965127681 3:164650622-164650644 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
965243010 3:166228038-166228060 CTCCAGCCAGAGAGAAAGGTCGG + Intergenic
965658781 3:171018673-171018695 CTGCAGCCTGACAGAAAGATGGG - Intronic
967133834 3:186496589-186496611 CTGCAGCCTCTGAGAGAGCTGGG - Intergenic
967343485 3:188427419-188427441 GGGCAGCCAGAGAGAAAGATTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971628596 4:28958509-28958531 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
971643953 4:29172029-29172051 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
972255698 4:37353248-37353270 GGGCAGCCATAGAGAAAGGTTGG - Intronic
972455313 4:39248089-39248111 GTGCAGCCAGAGAGAAAGGTTGG + Intronic
973250606 4:48056364-48056386 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
974110070 4:57514986-57515008 CTGCAGCAATACAGGGAGCTGGG - Intergenic
974513352 4:62874295-62874317 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
974780519 4:66546799-66546821 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
974871908 4:67654274-67654296 AGGCAGCCAGAGAGAGAGATTGG + Intronic
974954420 4:68620496-68620518 GGGCAGCCAGAGAGAAAGATCGG + Intronic
975034735 4:69665608-69665630 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
975309133 4:72883156-72883178 CGGCAGCCAGAGAGAAAGGTTGG - Intergenic
975840360 4:78467260-78467282 CTGAACCCATGGAGAGAGAGAGG - Intronic
976374051 4:84324347-84324369 CTGCAAACAGAGAGAGAGAGAGG - Intergenic
976515822 4:85965227-85965249 CAGCAGGCAAAGAGAGAGCTTGG + Intronic
977326316 4:95579189-95579211 GTGCAGCCAGAGAGAAAGGTGGG - Intergenic
977480115 4:97564838-97564860 CGGCAGCCAGAGAGAAAGGTCGG - Intronic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
978548424 4:109898704-109898726 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
979570853 4:122222674-122222696 ATGCAGGCACAGAGAGAGAGTGG - Intronic
979588064 4:122444710-122444732 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
979599615 4:122573589-122573611 GGGCAGCCAGAGAGAGAGGTCGG - Intergenic
980139435 4:128897260-128897282 GGGCAGCCAGAGAGAAAGATCGG + Intronic
980223129 4:129946361-129946383 GGGCAGCCATAGAGAAAGGTCGG - Intergenic
981296854 4:143142101-143142123 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
981832480 4:149018247-149018269 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
981870811 4:149483899-149483921 TTGGAGCTAAAGAGAGAGATAGG - Intergenic
981958213 4:150504330-150504352 ATGCAGCCAGAGAGAAAGGTCGG + Intronic
981984567 4:150838195-150838217 GGGCAGCCAGAGAGAAAGATCGG - Intronic
982106544 4:152016407-152016429 TTGCAGTCGGAGAGAGAGATTGG + Intergenic
982648928 4:158062377-158062399 TTGCAGGCATAGATAAAGATGGG - Intergenic
983108808 4:163723428-163723450 GGGCAGCCAGAGAGAAAGATCGG - Intronic
983175889 4:164587328-164587350 CAGCAGCCAGAGAGAAAGGTCGG + Intergenic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985202912 4:187503003-187503025 CTGCAGCCAGAAAGAGAAAAAGG - Intergenic
986027005 5:3860075-3860097 CAGAAGCCAGAGAGAGAGACAGG - Intergenic
986126934 5:4891971-4891993 GAGCAGCCAGAGAGAAAGATCGG - Intergenic
986750445 5:10781969-10781991 GGGCAGCCATAGAGAAAGGTCGG + Intergenic
986866524 5:11995765-11995787 ATGCAGCCATAAAAAGGGATGGG + Intergenic
987220691 5:15788071-15788093 GTGCAGACAGAGACAGAGATTGG - Intronic
988269246 5:28992759-28992781 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
988355011 5:30162421-30162443 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
988668753 5:33359103-33359125 CGGCAGGCAAAGAGAGAGATTGG + Intergenic
988669046 5:33361328-33361350 TGGCAGGCAAAGAGAGAGATTGG + Intergenic
989404841 5:41048787-41048809 ATGGGGCCAAAGAGAGAGATGGG + Intronic
989516966 5:42354906-42354928 GGGCAGCCAGAGAGAAAGATGGG + Intergenic
990680881 5:58242797-58242819 CTGCAGCCAGACAGAGAGAGAGG + Intergenic
990884269 5:60574365-60574387 CGGCAGCCAGAGAGAAAGGTTGG - Intergenic
990976332 5:61564777-61564799 CTGCAGCCACAGAGGGCCATGGG + Intergenic
991242511 5:64475795-64475817 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
991301315 5:65131988-65132010 GTGCAGCCATACACATAGATGGG + Intergenic
992354718 5:75968912-75968934 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
992762364 5:79962098-79962120 CTCCAGCCAGAGAGAGACCTGGG - Intergenic
993052890 5:82945759-82945781 GGGCAGCCAGAGAGAGAGGTTGG + Intergenic
993449285 5:88053931-88053953 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
994004984 5:94827373-94827395 GGGCAGCCAGAGAGAAAGATCGG - Intronic
995004434 5:107174008-107174030 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
995151411 5:108851278-108851300 CAGCAGGCAAAGAGAGAGATTGG + Intronic
995665267 5:114535055-114535077 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
996270965 5:121603890-121603912 GGGCAGCCACAGAGAGAGAAAGG + Intergenic
997087586 5:130819333-130819355 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
997220179 5:132155827-132155849 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
997420429 5:133762812-133762834 CTGGAGGGATAGAGAGAGAGAGG - Intergenic
998203753 5:140145149-140145171 CTGCAGCGCTAGAGACAGAGGGG - Intergenic
998432890 5:142081774-142081796 CTGCAACCACAGAGAGGAATGGG - Intergenic
999230546 5:150059351-150059373 CTGGAGCCCTAGTAAGAGATGGG - Intronic
999328802 5:150659333-150659355 AAGCAGCCATGGGGAGAGATGGG + Intergenic
999709087 5:154300555-154300577 CTGCAGTGAGAGAGAGAGACAGG + Intronic
999958405 5:156727094-156727116 TTGCAGCCAGGGAGAGAAATTGG + Intronic
1000131542 5:158304930-158304952 CTGCAGCCAAAGAGACACCTGGG + Intergenic
1000424323 5:161072946-161072968 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1000717566 5:164665318-164665340 CAGCAGGCAAGGAGAGAGATTGG - Intergenic
1000860244 5:166448924-166448946 CGGCAGCCAGAGAGAAAGGTTGG - Intergenic
1001205477 5:169758510-169758532 ATGAAGGCATAGAGAGAGAGAGG + Intronic
1001283448 5:170405169-170405191 CTCCAGCCACAGAGAGAAAAGGG + Intronic
1002503858 5:179665506-179665528 TTGCAGCTATGCAGAGAGATGGG - Intergenic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1002928177 6:1617051-1617073 CTTCAGCCAAGCAGAGAGATTGG + Intergenic
1003295232 6:4820480-4820502 ATGCTGCCAGAGAGAGAGAGAGG - Intronic
1003308585 6:4949513-4949535 CTGGAACCATCCAGAGAGATGGG - Intronic
1003699457 6:8446051-8446073 CAGCAGCCAGAGAGAAAGGTTGG - Intergenic
1007199506 6:40094731-40094753 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1008401180 6:51064906-51064928 CTGCAGCCACAAAGAGGGACTGG + Intergenic
1009166602 6:60349151-60349173 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
1009490901 6:64289444-64289466 CTCCTGCCATAGAGGGAAATTGG - Intronic
1010004035 6:70975889-70975911 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010671909 6:78696038-78696060 CAGCAGCCAGAGAGAAAGGTCGG + Intergenic
1010677374 6:78759858-78759880 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
1010936766 6:81871335-81871357 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1011408114 6:87037596-87037618 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1011788978 6:90877688-90877710 CAGGAGCCATGCAGAGAGATTGG - Intergenic
1012540192 6:100353767-100353789 CTGCAGAGAGAGAGAGAGAGAGG - Intergenic
1012605817 6:101156654-101156676 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1012653974 6:101792612-101792634 CGGCAGCCAGAGAGAAAGGTCGG - Intronic
1014072452 6:117198811-117198833 CTGAAGGCATCAAGAGAGATGGG + Intergenic
1014711029 6:124806226-124806248 GGGCAGCCAGAGAGAAAGATCGG + Intronic
1014960024 6:127671827-127671849 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1015007079 6:128296461-128296483 GGGCAGCCATAGAGAAAGGTTGG + Intronic
1015107150 6:129550461-129550483 CTTCAGCCATATAGAAACATGGG + Intergenic
1015970722 6:138740587-138740609 CGGCAGGCAGAGAGAGAGACTGG + Intergenic
1016242043 6:141941826-141941848 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1017226702 6:152029878-152029900 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1017356848 6:153519869-153519891 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
1018096441 6:160390987-160391009 ATGAAGCCAGAGACAGAGATTGG - Intronic
1020640583 7:10748823-10748845 ATGCAGCCAGAGAGAAAGGTCGG + Intergenic
1020845149 7:13273093-13273115 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1021130742 7:16910431-16910453 TTACAGCTAAAGAGAGAGATAGG - Intergenic
1021165739 7:17338269-17338291 CAGCAGCTATAAAGACAGATTGG - Intronic
1021591465 7:22268091-22268113 GTGCAGCAATAAAGACAGATGGG - Intronic
1021798018 7:24277385-24277407 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1022406699 7:30097231-30097253 GGGCAGCCAGAGAGAAAGATCGG - Intronic
1022905630 7:34852613-34852635 CTGCATTCATAGTGATAGATAGG - Intronic
1023018802 7:35991523-35991545 CGGCAGGCAAAGAGAGAGATTGG + Intergenic
1024294713 7:47833019-47833041 CTGCAGCCATTGGGAGAGGCAGG - Intronic
1026549183 7:71352605-71352627 CTGGAGCTTGAGAGAGAGATAGG + Intronic
1027621171 7:80487332-80487354 CTGTAGCCAGAGAGATAGATTGG + Intronic
1028436321 7:90808202-90808224 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1028713573 7:93938653-93938675 CTGCAACCAAAGAGAGAGGAAGG - Intergenic
1029109144 7:98203390-98203412 CTGCAGGCAGAGGGAGAGACAGG + Intronic
1029536598 7:101161020-101161042 CTGCAGCCAAGGAGAAAGAGGGG - Exonic
1029810219 7:103039563-103039585 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1030110032 7:106019113-106019135 AGGCAGCCATAGACAAAGATTGG + Intronic
1030752779 7:113251063-113251085 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
1030770935 7:113474331-113474353 GGGCAGCCAGAGAGAAAGATTGG - Intergenic
1030915058 7:115302871-115302893 CGGCAGGTAAAGAGAGAGATTGG - Intergenic
1031188181 7:118510721-118510743 CTGGTGCTATAAAGAGAGATTGG - Intergenic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1031949005 7:127872250-127872272 AAGCAGCTATAGAGAGAGCTGGG + Intronic
1033106925 7:138535620-138535642 GGGCAGCCAGAGAGAAAGATCGG - Intronic
1033996265 7:147353475-147353497 ATGCAGCCATAGAAAAGGATGGG - Intronic
1034236779 7:149578208-149578230 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1035638605 8:1165115-1165137 CTGCTGCCAGATAGAGAGAGAGG + Intergenic
1035650385 8:1259657-1259679 CTGCTTCCACAGGGAGAGATGGG + Intergenic
1035921274 8:3678774-3678796 GTGCAGCCAGAGAGAAAGGTCGG + Intronic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1038083128 8:24162937-24162959 GTGCAGCCAGAGAGAAAGTTTGG - Intergenic
1038110504 8:24491664-24491686 CAGCAGCCTTAGGGAGAGTTGGG - Intronic
1038197926 8:25385101-25385123 CAGCAGGCACAGAGAGAGCTGGG + Intronic
1038255696 8:25948878-25948900 CTGCAACCATAGTTAGAGTTTGG - Intronic
1039154248 8:34537144-34537166 GTGCAGCCAGAGAAAAAGATTGG + Intergenic
1039866773 8:41511825-41511847 CTGCAGCTGGAGACAGAGATGGG + Intergenic
1040364689 8:46703667-46703689 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1040398285 8:47020331-47020353 GTGCAGCCACAGAGAAAGGTTGG + Intergenic
1040613115 8:49005945-49005967 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1041217736 8:55617473-55617495 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
1041289450 8:56295117-56295139 CTGCAGCCATTTACAGATATGGG + Intergenic
1041323138 8:56635735-56635757 GGGCAGCCAAAGAGAAAGATCGG - Intergenic
1041399931 8:57431682-57431704 ATGGAGCCATACAGAGATATAGG + Intergenic
1041424417 8:57703964-57703986 CTGGAGCCACAGAGAGGGATGGG - Intergenic
1041630386 8:60081351-60081373 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1042362212 8:67895666-67895688 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
1042522900 8:69733359-69733381 ATGCTGACATAGAGAGAGACAGG + Intronic
1042541248 8:69909007-69909029 GTGCAGCCAGAGAGAAAGGTCGG + Intergenic
1042774133 8:72410975-72410997 ATGCAGCCATAAAAAGAAATGGG + Intergenic
1043221804 8:77674759-77674781 CAGCAGCCATAGCCAGAGCTTGG + Intergenic
1043537820 8:81225856-81225878 CTGCAACCATTGTGGGAGATGGG + Intergenic
1043553669 8:81404476-81404498 CTGCAGACATAGAAAGAGACAGG + Intergenic
1044501329 8:92962051-92962073 TTGCAACAATAGAGTGAGATAGG - Intronic
1045507274 8:102787705-102787727 CTGAAGACAGAGACAGAGATTGG - Intergenic
1045537711 8:103047881-103047903 TTGCAGACAGAGAGAGAGAAAGG - Intronic
1045797872 8:106066811-106066833 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1046629671 8:116610898-116610920 CTGCAGCGGGAGAGAGAGATTGG + Intergenic
1047957045 8:129984182-129984204 CTGCAGCCAGAGAGAGGCAGGGG - Intronic
1048796538 8:138155032-138155054 GGGCAGCCAGAGAGAAAGATTGG + Intronic
1048976808 8:139677769-139677791 CTGCAGCCATGGGGACACATTGG - Intronic
1049822446 8:144644218-144644240 CTTCAGCCATAGAGAGGGATTGG + Intergenic
1051060499 9:13039484-13039506 GAGCAGCCAGAGAGAGAGGTCGG + Intergenic
1051192929 9:14534067-14534089 CAGCAGCCAGGGAAAGAGATGGG + Intergenic
1051913030 9:22176693-22176715 CTGCACACATAAAGAGAGTTAGG - Intergenic
1052063926 9:23993432-23993454 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
1052235248 9:26205378-26205400 CTGCAGCCAGGGAAAGAGAAAGG + Intergenic
1052408641 9:28094486-28094508 ATGAAGCAATAGAGAGAGAAAGG + Intronic
1052814556 9:33091221-33091243 ATGCAGCCATAGAAAAGGATGGG + Intergenic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1053411871 9:37921016-37921038 CTGCAGCCCTGGTGAGAGCTGGG - Intronic
1055175436 9:73313020-73313042 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1056051426 9:82773751-82773773 CGGCAGCCAGAGAGAAAGGTCGG - Intergenic
1056303491 9:85267104-85267126 ATGCAGTCATAGAGGGAGAAGGG - Intergenic
1056870558 9:90273484-90273506 GAGCAGACATAGAGAAAGATGGG - Intergenic
1057555618 9:96085465-96085487 CGGCAGCCATGGAAAGAGGTGGG - Intergenic
1058182698 9:101817247-101817269 CGGCAGCCAGAGAGAAAGGTTGG + Intergenic
1058506820 9:105674805-105674827 CTGCAGCCTGAGAGAGATATGGG + Intergenic
1059547909 9:115197324-115197346 CTACAGCCATGTAGGGAGATGGG - Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060387380 9:123244103-123244125 ATTCAGCAATAAAGAGAGATGGG + Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1061833443 9:133311612-133311634 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1062306701 9:135911365-135911387 CGGCAGGCAAAGAGCGAGATTGG + Intergenic
1062526736 9:136980973-136980995 CTGCAGCCATCGGGAAGGATGGG - Intronic
1062681839 9:137786366-137786388 CTCCAGGAAGAGAGAGAGATTGG + Intronic
1203358951 Un_KI270442v1:194040-194062 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1185750479 X:2607060-2607082 CTGGAGGGGTAGAGAGAGATGGG - Intergenic
1187522125 X:20023030-20023052 ATGCAGCCCTAGACAGAGCTTGG + Intronic
1187789287 X:22931775-22931797 CTGAAGACATAGAGAAAGAGTGG - Intergenic
1187790095 X:22941384-22941406 CTGCAAATATAGAGAGAGCTGGG + Intergenic
1188415239 X:29925177-29925199 ATGCTGCCATAAAGAGAGGTAGG - Intronic
1188660932 X:32757870-32757892 CTGCAGCAAAAATGAGAGATGGG - Intronic
1189217988 X:39343913-39343935 CTGCAGTCTGAGAGATAGATGGG + Intergenic
1190887297 X:54541210-54541232 CTGCAGCCTAAGGGAGGGATGGG - Intronic
1190975711 X:55398262-55398284 GGGCAGCCAGAGAGAAAGATTGG + Intergenic
1190997734 X:55627479-55627501 GGGCAGCCATAGAGAAAGGTCGG + Intergenic
1191579457 X:62743897-62743919 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1191720899 X:64227672-64227694 CTGGAGCTAAAGAGAGAGCTGGG - Intronic
1191782166 X:64880417-64880439 GGGCAGCCAGAGAGAAAGATGGG + Intergenic
1192087441 X:68114681-68114703 CTTCAGCCTGAGAGAGAGAAGGG + Intronic
1192369063 X:70498497-70498519 CTGCAACAAAAAAGAGAGATAGG - Intronic
1192385369 X:70662602-70662624 GTGCAGCCAGAGAGAAAGGTCGG + Intronic
1192954153 X:76051200-76051222 CGGCAGCCAGAGAGAAAGGTCGG - Intergenic
1192973293 X:76255698-76255720 ATGCAGCCATAGAAAAGGATGGG - Intergenic
1192994173 X:76494380-76494402 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1193003518 X:76590028-76590050 CTGCAGACAGAGAGAAAGGTTGG - Intergenic
1193087050 X:77456139-77456161 CTCCAGTAATACAGAGAGATAGG + Intronic
1193673797 X:84421917-84421939 TTACAGCTAAAGAGAGAGATGGG + Intronic
1193729848 X:85089656-85089678 CTACAGCACTAGAGAGATATGGG - Intronic
1193906939 X:87255289-87255311 CAGCAGCCAGAGAGAAAGGTCGG + Intergenic
1194364547 X:92997235-92997257 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic
1194457266 X:94120397-94120419 CTAGAGCAAAAGAGAGAGATAGG - Intergenic
1194771978 X:97916985-97917007 CAGCAGCCAGAGAGAAAGCTTGG + Intergenic
1195154937 X:102113548-102113570 CTGCTGCCAGGGAGAGAGCTGGG - Intergenic
1195171973 X:102278324-102278346 CTAGAGCTAAAGAGAGAGATGGG - Intergenic
1195186887 X:102408769-102408791 CTAGAGCTAAAGAGAGAGATGGG + Intronic
1195375892 X:104227891-104227913 CAGCAGGCAAAGAGAGAGAGAGG - Intergenic
1195452676 X:105033628-105033650 GGGCAGCCAGAGAGAAAGATTGG - Intronic
1195665226 X:107423426-107423448 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1195844991 X:109217142-109217164 CTGCAGGTATAGGGAGAGGTTGG + Intergenic
1196435786 X:115673324-115673346 CGGCAGCCAGAGAGAAAGGTCGG + Intergenic
1196474609 X:116068300-116068322 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1197307910 X:124866020-124866042 TTGGAGCTAAAGAGAGAGATAGG + Intronic
1197365466 X:125560507-125560529 TTACAGCTAAAGAGAGAGATGGG + Intergenic
1198022031 X:132668458-132668480 CTGAAGCCAAAGGGAGAGATCGG + Intronic
1198704849 X:139437406-139437428 GTGCAGACAGAGAGAAAGATCGG + Intergenic
1198938666 X:141928663-141928685 TTACAGCTAAAGAGAGAGATAGG - Intergenic
1199094935 X:143726901-143726923 GGGCAGCCAGAGAGAAAGATGGG + Intergenic
1199588103 X:149437411-149437433 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1200354480 X:155534068-155534090 CAGAAGCCATAAACAGAGATGGG + Intronic
1200672772 Y:6113500-6113522 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic
1200689529 Y:6293164-6293186 GTGCAGCCAGAGAGAAAGGTTGG - Intergenic
1200741067 Y:6854027-6854049 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1201015085 Y:9592839-9592861 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
1201045743 Y:9881556-9881578 GTGCAGCCAGAGAGAAAGGTTGG + Intergenic
1201418720 Y:13775114-13775136 GTGCAGCCAGAGAGAAAGGTCGG - Intergenic
1201702896 Y:16903373-16903395 GGGCAGCCAGAGAGAAAGATCGG + Intergenic
1201956399 Y:19628544-19628566 GGGCAGCCAGAGAGAAAGATCGG - Intergenic
1202023876 Y:20499183-20499205 TTACAGCCACAGAGAGAAATAGG - Intergenic
1202067185 Y:20952239-20952261 CTGAAGACAGATAGAGAGATAGG + Intergenic