ID: 1052981522

View in Genome Browser
Species Human (GRCh38)
Location 9:34453422-34453444
Sequence CCTCACCCTCTCCCAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052981519_1052981522 13 Left 1052981519 9:34453386-34453408 CCAAGCTCATGTAGTCAGAGTCA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG No data
1052981517_1052981522 18 Left 1052981517 9:34453381-34453403 CCTTCCCAAGCTCATGTAGTCAG 0: 1
1: 0
2: 3
3: 15
4: 164
Right 1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG No data
1052981518_1052981522 14 Left 1052981518 9:34453385-34453407 CCCAAGCTCATGTAGTCAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052981522 Original CRISPR CCTCACCCTCTCCCAAAGCA GGG Intronic
No off target data available for this crispr