ID: 1052989172

View in Genome Browser
Species Human (GRCh38)
Location 9:34508646-34508668
Sequence CTGCTTGGCTTGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 381}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052989172 Original CRISPR CTGCTTGGCTTGAGGAAGGA AGG (reversed) Intronic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900982389 1:6053608-6053630 CGGCTAGGCTGGAGGGAGGAAGG + Intronic
901081123 1:6584816-6584838 CTGCTTGGCCTCTGGAAGGTGGG + Intronic
901120649 1:6890403-6890425 CTTCCTGGGTTAAGGAAGGAAGG + Intronic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901933575 1:12613140-12613162 CTCCTTGGCTTATGGAAGCATGG - Intronic
902206186 1:14869914-14869936 TTGGGTGGCTTCAGGAAGGAAGG - Intronic
902374443 1:16023708-16023730 CTGCTTGGCTCCAGGCAGGGAGG - Intronic
902690651 1:18108332-18108354 CTGGTTGGCTCGATGAGGGAGGG + Intronic
902741409 1:18441116-18441138 CAGCCTGCCTTGAGGAAGGGTGG + Intergenic
903111487 1:21138438-21138460 CTCCTTGGTTTGGGGAAGGAGGG - Intronic
903183666 1:21617889-21617911 CTCCTGGGCTTGAGTAAGGGTGG + Intronic
903183720 1:21618157-21618179 CTCCTTGCCTGGAGAAAGGAGGG + Intronic
903590767 1:24454235-24454257 CTGCTTCTCCTCAGGAAGGATGG - Intronic
903590783 1:24454338-24454360 CAGCGTGGCTTAAGGAGGGAGGG - Intronic
904275894 1:29384135-29384157 CAGCTGGGCATCAGGAAGGAAGG + Intergenic
905850861 1:41273649-41273671 TTGGCTGGCTCGAGGAAGGAAGG + Intergenic
906694668 1:47816011-47816033 CTCCTTGGTGTCAGGAAGGAGGG - Intronic
906960511 1:50416920-50416942 CAGCTCGGCGTGAGGAGGGAAGG + Intergenic
909799562 1:79789143-79789165 CTGATTGGCTTGGGCAAGGAGGG - Intergenic
910228099 1:84957027-84957049 TTCCTTGGCTTGGGGAGGGAAGG - Intronic
910766784 1:90790077-90790099 CTGCTGGCTTTGAGGATGGAAGG + Intergenic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912458554 1:109816259-109816281 CAGCTTGGAGTGAGGAAGGCAGG - Intergenic
912458680 1:109817115-109817137 TTGGCTGGCTGGAGGAAGGATGG + Intergenic
915476949 1:156158642-156158664 ATGAGGGGCTTGAGGAAGGAAGG - Intronic
918263134 1:182814831-182814853 GTCCATGGCTTGAGGAAGAACGG - Exonic
919737686 1:200963526-200963548 CTGCTTGGGTTGAAGGAGGTGGG - Intergenic
920051106 1:203165700-203165722 ATGCTGGGCTTGTGGCAGGACGG - Exonic
920170266 1:204067687-204067709 CTGCTTGGCTTCAGGGAGTGGGG - Intergenic
920305101 1:205013747-205013769 CTGGGTGGCATGAGGAGGGAGGG - Intronic
920923717 1:210321767-210321789 CTGCTTGTCTTGGAGAAGTAAGG - Intergenic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
921617085 1:217281605-217281627 CAGCTTGGCTTCAGTAAGGAAGG + Intergenic
922879607 1:228970764-228970786 CTGCTTCACTTCAGAAAGGAAGG - Intergenic
923113547 1:230913325-230913347 CTGCCTTGATTGAGGAAGGAAGG + Intronic
1065114269 10:22469229-22469251 CTGCTTGGTTGGGGGAAGGCTGG + Intergenic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1066299449 10:34083990-34084012 CTGATTGGAGTGATGAAGGATGG + Intergenic
1066415825 10:35220630-35220652 GTGCTTGGCTCGAGGAACCATGG + Intergenic
1066763592 10:38782333-38782355 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1066958227 10:42193310-42193332 GTGATTGACTTGGGGAAGGAGGG - Intergenic
1069589828 10:69634849-69634871 CTGCCTGGCTTTAGGCAGGATGG + Intergenic
1070312033 10:75280968-75280990 CTGCCTGGCTGGAGCAAGGCAGG + Intergenic
1070713742 10:78702531-78702553 CTGTCTGGCCTGAGGAGGGAGGG - Intergenic
1070762035 10:79029909-79029931 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
1070791572 10:79192579-79192601 CTGCCCTGGTTGAGGAAGGAGGG + Intronic
1070930911 10:80259965-80259987 CTGGTTACCTTGATGAAGGAAGG - Intergenic
1070963047 10:80512301-80512323 CTTCTGGGCTTCAGGAAGGGCGG - Intronic
1070969210 10:80549686-80549708 CTGCTGGGCCTGAGGAAGGCAGG - Intronic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074205931 10:111282659-111282681 CTGCTTGGCTCAAAGGAGGAGGG - Intergenic
1075746266 10:124730077-124730099 CTGTGTGGCATGAGGAAGGAAGG - Intronic
1075764122 10:124879333-124879355 TTCCTTGCCTTGAGGAGGGAGGG - Intergenic
1076076221 10:127535873-127535895 ATCCTCGGCTAGAGGAAGGAAGG + Intergenic
1076400695 10:130182699-130182721 CTGCTTGGCTGTAGGAAGTAGGG - Exonic
1078469985 11:11578973-11578995 CCCCCTGGCTTCAGGAAGGAAGG + Intronic
1078480941 11:11674742-11674764 CTGCTTGGAATGTGCAAGGATGG + Intergenic
1079008803 11:16811763-16811785 ATCCTAGGCTTTAGGAAGGAAGG - Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080303399 11:30810559-30810581 GTGGTTGAGTTGAGGAAGGAAGG - Intergenic
1080556446 11:33421673-33421695 CTCCATGTTTTGAGGAAGGAAGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1084121073 11:67069294-67069316 CTGCTTGCCTGGTGGAGGGAGGG - Intronic
1084433016 11:69122051-69122073 CTCCTTGGGGTGGGGAAGGATGG - Intergenic
1084570552 11:69957093-69957115 ATGCTGGGCTGGATGAAGGAAGG - Intergenic
1085809497 11:79667502-79667524 CTGCATTGCTCGAGGAAGGTAGG - Intergenic
1086723300 11:90148339-90148361 GTGATTGACTTGGGGAAGGAGGG + Intronic
1087328140 11:96748017-96748039 CTGAAAGGCTTGATGAAGGAAGG + Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089553504 11:119300456-119300478 CTGCTTGGCCTCAGTAAGGCTGG - Exonic
1090590593 11:128262720-128262742 GGGCTGGGCTAGAGGAAGGAAGG + Intergenic
1090736938 11:129618357-129618379 GTGCTTGGCTAGAGAAAGGGCGG + Intergenic
1091194296 11:133718356-133718378 CTGCTGGGCTTGAGAAAGCCTGG - Intergenic
1091347395 11:134864508-134864530 CTGCTTGGAAAGAGCAAGGAGGG - Intergenic
1092032153 12:5295277-5295299 CTTTTTGGCCTTAGGAAGGAAGG - Intergenic
1092704838 12:11271160-11271182 CAGCTTGGCTGGAGGTATGATGG + Intergenic
1092930020 12:13307072-13307094 CTTCTTGGCCTGAGGGTGGAGGG + Intergenic
1094494155 12:30979006-30979028 CTGCCTGGATTAAGCAAGGATGG + Intronic
1095869234 12:47007658-47007680 CTCCTTGGCTAGAGCTAGGAAGG + Intergenic
1096804542 12:54132464-54132486 CAGGGAGGCTTGAGGAAGGAGGG - Intergenic
1096874589 12:54617396-54617418 CTGCTTGGCTTGAGGGTGGAGGG + Intergenic
1098110981 12:67121633-67121655 ATGGTTGCCTTGAGAAAGGAGGG - Intergenic
1098311934 12:69157191-69157213 CTGCAAGGCTGGAGGAGGGAAGG - Intergenic
1099658398 12:85524569-85524591 CTACTTGGCCTGAGAAAGGGAGG - Intergenic
1100428607 12:94510178-94510200 GTGCATGGCGTGAAGAAGGAGGG + Intergenic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1104043679 12:125146511-125146533 CTGCTTTGCTTGAGCTGGGATGG + Intergenic
1104054662 12:125220270-125220292 CAAGGTGGCTTGAGGAAGGAAGG - Intronic
1105635022 13:22208377-22208399 GTGATTGGCTGGAGGAAAGAAGG + Intergenic
1105821413 13:24084308-24084330 CTGCTTCTTTTGAGAAAGGAAGG + Intronic
1107157569 13:37187182-37187204 CTGCTTTGCTGGAGGAAGTATGG + Intergenic
1109902124 13:68787827-68787849 CTTCTTGGCTTGCGGATAGATGG - Intergenic
1110234786 13:73205400-73205422 GTCCTTGGCTTGGGGAATGAAGG + Intergenic
1110333780 13:74302741-74302763 CTGCTTGGCTTGGAGAAAGCAGG + Intergenic
1111936689 13:94565207-94565229 CTGCCTGGGGTGAGGAGGGAGGG + Intergenic
1112389828 13:98972845-98972867 CAGCAAGGCATGAGGAAGGAAGG - Intronic
1113842657 13:113369252-113369274 CTGCTTGCTTTCAGGCAGGAGGG - Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1116039863 14:39672907-39672929 CTGCTTGGCTAGGGTAAGTATGG + Intergenic
1116845809 14:49863820-49863842 CTACTGGGTTTGAGGTAGGAGGG - Intergenic
1117743770 14:58846430-58846452 CCACTGGCCTTGAGGAAGGAAGG + Intergenic
1121429717 14:93878388-93878410 CTGCTAGGCTTGGGGGAGGCAGG + Intergenic
1121943106 14:98092214-98092236 CTGCATGGTTTCAGGAAGGTGGG + Intergenic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122619810 14:103049287-103049309 CTGCTTGGCTGAAGGAGGGTGGG + Intronic
1122778934 14:104135588-104135610 ATGCCTGGCTTGAGGGAGGAAGG - Intergenic
1202934896 14_KI270725v1_random:78564-78586 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1124871607 15:33548852-33548874 CTGCTTGGAATGAGAGAGGAGGG + Intronic
1125958147 15:43805376-43805398 CTGCATGACTTTAGGAAGAATGG + Exonic
1126255600 15:46621752-46621774 CTTCTTGGCTCAAGTAAGGATGG - Intergenic
1126732486 15:51698551-51698573 CTGTTTGGCTTAAGCAAGAAAGG + Intronic
1126853923 15:52818947-52818969 CAGCTTCACCTGAGGAAGGAAGG + Intergenic
1127209921 15:56763325-56763347 CTGCTTGGCTTTGGAAATGATGG + Intronic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1128731387 15:70023841-70023863 GTGCCTGGCTGGAGTAAGGAAGG - Intergenic
1128856081 15:71016996-71017018 TTGTTGGGCTTGAGGCAGGAGGG + Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129033701 15:72637250-72637272 CTGCTTCCCTGGCGGAAGGAAGG + Intergenic
1129216180 15:74099966-74099988 CTGCTTCCCTGGCGGAAGGAAGG - Intergenic
1130626652 15:85522696-85522718 CTGCTTGGCTTGGGTAGGCAGGG - Intronic
1131511516 15:93051798-93051820 CGGGCTGGCTCGAGGAAGGAGGG + Intronic
1132751076 16:1458014-1458036 CAGCTTTGCCTCAGGAAGGAAGG - Intronic
1133512710 16:6475397-6475419 CTGCTACGCTTCAGGAATGAGGG + Intronic
1134215317 16:12312670-12312692 CTGCTTGGCTTTGGGACAGAGGG + Intronic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1136317588 16:29463474-29463496 GGGCTTGACTGGAGGAAGGAGGG + Intronic
1136432163 16:30202819-30202841 GGGCTTGACTGGAGGAAGGAGGG + Intronic
1138181745 16:54945211-54945233 GTGGTTGGCTTTAGGAAGGAGGG - Intergenic
1138510186 16:57504175-57504197 CTGACTCCCTTGAGGAAGGAGGG - Intergenic
1139573922 16:67829613-67829635 CTGCTTGGCTGGAGCTAGGTGGG - Intronic
1140410216 16:74736687-74736709 TGGCTTAGCCTGAGGAAGGATGG + Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1145275085 17:21424359-21424381 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145312939 17:21710259-21710281 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145797765 17:27665876-27665898 CTTCAGGGCTTGAGCAAGGAAGG - Intergenic
1149974949 17:61256218-61256240 CCTCTTGGCTTGAAGATGGAAGG - Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1151055855 17:71030899-71030921 TGGGCTGGCTTGAGGAAGGAAGG - Intergenic
1151290694 17:73147872-73147894 CTGCTTGGCAAGAGGAGAGAGGG - Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152331968 17:79678749-79678771 AGGCTGGGGTTGAGGAAGGAGGG - Intergenic
1152515323 17:80820187-80820209 CTGCATGGCTTTGGTAAGGAGGG + Intronic
1153013888 18:565820-565842 CTGCTTGGCTTGCGGAGTCAGGG - Intergenic
1153812262 18:8762583-8762605 CTACGTGGAGTGAGGAAGGACGG + Intronic
1155782189 18:29850357-29850379 CTGCTAGGGTTGGGGAGGGATGG + Intergenic
1160024844 18:75208957-75208979 CTGCATGGCTTGGGGAATGGCGG + Exonic
1161249220 19:3271315-3271337 CTGCTAGGCTGGAGGCAGGAGGG - Intronic
1161778758 19:6278278-6278300 CTTCTGGGCTTGAGGAAGAGGGG + Intronic
1162915811 19:13873847-13873869 CTGCTTGGCTTGCGGGGGGTGGG + Intronic
1163425851 19:17240670-17240692 CGGGTGGGCATGAGGAAGGAGGG - Exonic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1164605334 19:29593888-29593910 CCCCTTGGCTTGAGGACGTAAGG - Intergenic
1164808607 19:31138479-31138501 CCACTTGCCTTAAGGAAGGATGG + Intergenic
1165131508 19:33635290-33635312 CTGCTAAACTTGAGGAGGGAGGG - Intronic
1165446497 19:35859675-35859697 CTCCTGGGTATGAGGAAGGAGGG + Intronic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165834077 19:38743846-38743868 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166296672 19:41893331-41893353 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1166306307 19:41938628-41938650 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306504 19:41939183-41939205 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306696 19:41939738-41939760 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166377264 19:42334473-42334495 GGGCCTGGCTGGAGGAAGGAGGG - Intronic
1166476875 19:43134185-43134207 CTCATTGGCTGGAGGAATGATGG + Intronic
1166525375 19:43507172-43507194 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166532651 19:43552330-43552352 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166569510 19:43784819-43784841 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1166686776 19:44800935-44800957 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686903 19:44801367-44801389 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686965 19:44801583-44801605 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166687027 19:44801799-44801821 CTACTGGGTCTGAGGAAGGAGGG - Intergenic
1167265042 19:48478969-48478991 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167286122 19:48599704-48599726 CTCCCGGGTTTGAGGAAGGAGGG + Intergenic
1167314278 19:48754967-48754989 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314291 19:48755004-48755026 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167435511 19:49476354-49476376 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1167489248 19:49782238-49782260 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167557846 19:50206615-50206637 CTGCTGGGCTTGGGGATGGGAGG + Intronic
1167630886 19:50625685-50625707 CTCTTGGGCCTGAGGAAGGAGGG - Intronic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167689127 19:50974916-50974938 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167689188 19:50975083-50975105 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167690102 19:50980034-50980056 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167746233 19:51353358-51353380 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746247 19:51353395-51353417 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746261 19:51353432-51353454 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746276 19:51353469-51353491 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746291 19:51353506-51353528 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746306 19:51353543-51353565 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746321 19:51353580-51353602 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746336 19:51353617-51353639 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746398 19:51353802-51353824 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746452 19:51353950-51353972 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
1167943203 19:52963881-52963903 CTGCTTTGGTTCAGAAAGGAGGG + Intergenic
1168106618 19:54169412-54169434 CTCCTGGGTTTGAGGGAGGAGGG - Intronic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238535 19:55078303-55078325 CTCCTAGGTTTGAGGGAGGAGGG + Intronic
1168238725 19:55078821-55078843 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1168238753 19:55078895-55078917 CTCCTAGGTTTGAGGGAGGAGGG + Intronic
1168252175 19:55147351-55147373 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168252214 19:55147460-55147482 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168306349 19:55438152-55438174 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925445718 2:3925133-3925155 CTGCTGGGCTTGAATATGGAAGG - Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
926244988 2:11116459-11116481 CTGCTTGGCTTGCCGTAGCAAGG - Intergenic
926862354 2:17322332-17322354 CAGCTTGGCCTCAGGAAGTAAGG + Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
927492907 2:23532382-23532404 GTGCTTGGCTTGAAGCAGAATGG + Intronic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928671002 2:33603385-33603407 TTGCTGGTCTTGATGAAGGAGGG - Intergenic
929557428 2:42934383-42934405 TTTCTTGGCTGGAGGGAGGAGGG - Intergenic
932412765 2:71557085-71557107 CTGCCAGGCTTCAGGAAGGTTGG - Intronic
933188969 2:79311744-79311766 CAGCTTTGCTAGAGGAAGGATGG - Intronic
933543166 2:83674201-83674223 CTGATTGCCTTAAGGAGGGAGGG + Intergenic
934306342 2:91825718-91825740 GTGATTGACTTGGGGAAGGAGGG - Intergenic
934326914 2:92027024-92027046 GTGATTGACTTGGGGAAGGAGGG + Intergenic
934465292 2:94257579-94257601 GTGATTGACTTGGGGAAGGAGGG + Intergenic
934476407 2:94596418-94596440 GTGCATGGCTAGAGGAAGGTGGG + Intronic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935295790 2:101648171-101648193 TTGCTTGGCTTGAAGAGGGGAGG - Intergenic
935495883 2:103781321-103781343 GAGCTTGGCTTTAGGAAGAAGGG + Intergenic
936076943 2:109407539-109407561 CTGCCAGGCCTGAGGCAGGAAGG - Intronic
936624965 2:114138949-114138971 CTGCGTAGCTGAAGGAAGGAGGG - Intergenic
937470609 2:122171025-122171047 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
937919847 2:127121279-127121301 CTCATTGGCTTGAACAAGGAGGG + Intergenic
939408979 2:141799406-141799428 CTGCTTGGTTTGAAAATGGAGGG + Intronic
940357927 2:152765930-152765952 CTCCTTGGCTAGAAGAAGTATGG - Intergenic
940730780 2:157388517-157388539 GTGGTTGGCTTGAGGGTGGAGGG - Intergenic
941239457 2:163017850-163017872 TTCCTTGGCTAGAGGAGGGAGGG + Intergenic
942451674 2:176112272-176112294 GGGCTTTGCTGGAGGAAGGAGGG - Intronic
945100264 2:206256803-206256825 CTCCTTGGCTTGAGGCAGGGAGG + Intergenic
946013437 2:216584870-216584892 CAGATTGGCTAGAGGAAGCAGGG + Intergenic
946448575 2:219760837-219760859 CATCATGGCTGGAGGAAGGAAGG - Intergenic
946456562 2:219831492-219831514 ATGGTTGACTTGAGGATGGAGGG - Intergenic
946688723 2:222295327-222295349 CTGCTTGTCCTGGGGACGGAGGG - Intronic
948372489 2:237498464-237498486 CTGATATGCTGGAGGAAGGAGGG + Intronic
948429738 2:237911889-237911911 CTTCTTGGCTGGAAGAAGGGGGG - Exonic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169788928 20:9389109-9389131 CTGCTTAGCTTTAGAAAGAAAGG - Intronic
1170888606 20:20361190-20361212 CTGCATGGATTCAGGAATGAGGG + Intergenic
1171162911 20:22944743-22944765 CTGCTTGGCTGAAGGAAATAAGG + Intergenic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1172563136 20:35906854-35906876 ATGCAGGGCTTGAGGAGGGAGGG + Intronic
1172765219 20:37347056-37347078 TTGCTAGGCTGGTGGAAGGATGG + Intronic
1173539130 20:43838283-43838305 CTGCTTGGTCTGAGGAGGGAGGG + Intergenic
1174142897 20:48429024-48429046 CTGCTGGCTTTGAGGATGGAAGG - Intergenic
1174421865 20:50404575-50404597 CTGCTGGGCTGGTGGCAGGATGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1176030720 20:63009896-63009918 CTGCTGGGATTGGGGAAGGGAGG + Intergenic
1176596313 21:8700786-8700808 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1177418740 21:20827796-20827818 CTGATGGGGTTGAGGAAGGAGGG - Intergenic
1178989540 21:37341376-37341398 CTGCTGGGTTTGAGGGTGGAGGG - Intergenic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1180258762 21:46651641-46651663 CTCCTTGGCCTGAGTAATGATGG - Intronic
1180279226 22:10678235-10678257 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1180586441 22:16896770-16896792 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1181372840 22:22431818-22431840 CTCCTTGGCTTGAGGATGTCAGG - Intergenic
1181439184 22:22927067-22927089 CTGCTGGGCTTGAGGCAGGAAGG - Intergenic
1181560166 22:23695393-23695415 CTGGCCGGTTTGAGGAAGGAAGG - Intronic
1182579421 22:31296166-31296188 CTGATTGCCTTGAGGAAGGAAGG - Intergenic
1184266377 22:43349051-43349073 CTCCTTGGCATGTGGAAGGGCGG - Intergenic
1184686100 22:46097027-46097049 CAGCCTGACTTGAGGCAGGATGG + Intronic
1184929146 22:47667838-47667860 CTGCTTTTCTTATGGAAGGAGGG + Intergenic
1184958292 22:47908345-47908367 GTGCCTGGCCTGAGCAAGGATGG + Intergenic
949608802 3:5682504-5682526 CTGAGTGGCTTGGGCAAGGATGG - Intergenic
949792647 3:7809995-7810017 ATGCTAGGCTTGATGAAGAATGG + Intergenic
950309004 3:11939618-11939640 GTGGTTGGAGTGAGGAAGGAAGG + Intergenic
950550514 3:13663374-13663396 CTGCTGGCTTTGAGGATGGAGGG - Intergenic
950572649 3:13811576-13811598 CTGCTCTGCGTGAGGCAGGAGGG + Intergenic
951004881 3:17604006-17604028 GTTCTTGGCTTCATGAAGGAAGG - Intronic
952747487 3:36794961-36794983 TTGGATGGCTTAAGGAAGGATGG - Intergenic
953910149 3:46888753-46888775 CTACTTGGGTTGAGGAATCAAGG - Intronic
954628782 3:52037118-52037140 CTGCTGGGCTGGGGGAAGGTGGG + Intergenic
955450702 3:59064227-59064249 CTGCTCGGGTGGAGGTAGGAGGG + Intergenic
955798478 3:62662147-62662169 GAGCTTGCCTTGAGAAAGGAGGG + Intronic
956121660 3:65972071-65972093 CTGCCAGGCTGGAGGAAGGTGGG - Intronic
956441364 3:69283513-69283535 CTGTTTGTCTTGAGAAAGCAAGG - Intronic
957906283 3:86560433-86560455 CTGCTTGGCTTCATGATGGAAGG + Intergenic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
959821781 3:110743724-110743746 CTGACTGGCTGGAAGAAGGATGG - Intergenic
962492947 3:135911295-135911317 GTGCTTGGCTGGAGGCAAGAGGG + Intergenic
965727530 3:171734685-171734707 CTGTATGGCTTGGGGAAAGAAGG + Intronic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
968595323 4:1479296-1479318 CTCCATGGCTTGGGGATGGATGG + Intergenic
969149747 4:5159142-5159164 CTGCTTGGCTGGAGCACGGCTGG + Intronic
970401255 4:15719840-15719862 CTCCTTGTCTTGAGGAGGCATGG - Intronic
970769068 4:19588324-19588346 CTGATTTGCTTGAGAAAGCAAGG + Intergenic
972568582 4:40290461-40290483 TTACTTGACCTGAGGAAGGAGGG - Intergenic
972702645 4:41508818-41508840 CTGCCTTGCTTGCAGAAGGAAGG + Intronic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979120195 4:116889240-116889262 CTTCTTGGCTTGCAGAAAGATGG + Intergenic
979997025 4:127443539-127443561 CGGCTGGGCCTGAAGAAGGAAGG - Intergenic
981049812 4:140298647-140298669 CTGATTGGCCACAGGAAGGAAGG - Intronic
981398994 4:144289667-144289689 CTGCTTGACTAAAGGAAGAATGG + Intergenic
981510917 4:145557533-145557555 TTGCTGGTCTTGAGGAATGAAGG - Intronic
981789626 4:148521750-148521772 ATGCTTGGCTTGATGGAGGGAGG - Intergenic
982265966 4:153538615-153538637 CTGCTTGCCCTGAGGGAGGCGGG - Intronic
982319601 4:154064475-154064497 CTCCTAGGCTTCAGGAGGGAGGG - Intergenic
985233689 4:187849706-187849728 CTGCCTGGCCTGATTAAGGAGGG - Intergenic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
986749811 5:10776821-10776843 CTGGTGGGAATGAGGAAGGAGGG - Intergenic
987039519 5:14048699-14048721 GTGCCTGGGTTGAGGTAGGAAGG - Intergenic
988067315 5:26237665-26237687 CTGCTTGGCCACAGGAAGGAAGG - Intergenic
988419612 5:30989384-30989406 ATGCTTAGTTTGAGGAAGAATGG + Intergenic
989413898 5:41151438-41151460 ATGCTTAGTTTTAGGAAGGAAGG + Intronic
989577964 5:43006588-43006610 GTGCTTGGGTTGAGGAATCAAGG + Intergenic
992338875 5:75801013-75801035 CCTCTTGGCTTGAGGGAAGAGGG + Intergenic
993508889 5:88746727-88746749 CTGGTTGGCATGAGAAAGAAGGG + Intronic
994502202 5:100593224-100593246 CAACTTGGCTTCAGGAAGGTAGG + Intergenic
995002987 5:107158001-107158023 CTGCCTGGGTGGGGGAAGGAAGG + Intergenic
996272996 5:121630839-121630861 CTACTTGACAAGAGGAAGGAGGG + Intergenic
997205440 5:132045967-132045989 CTGCTGGGCTTAAAGATGGAGGG - Intergenic
997453311 5:134000540-134000562 CTGCTTGGCTTGACCAGGTAGGG + Intronic
998468905 5:142367751-142367773 CTGCTTGGCTAAAGGTGGGAGGG + Intergenic
999991318 5:157052837-157052859 CTGCTTTTCTTTTGGAAGGAGGG - Intronic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1000962364 5:167614863-167614885 CTGCTTGCCTTGTGGAAGAATGG - Intronic
1001078548 5:168649395-168649417 CTGCTTGGCTTCTGGTAGGGTGG + Intergenic
1001269809 5:170302722-170302744 CTGCCTGCCTTAAGGATGGAGGG - Intergenic
1002588220 5:180266693-180266715 CTACTTGGGCTGAGGCAGGAGGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004835010 6:19520993-19521015 CTGCTGGGCTTCAGGAAGTTGGG - Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1006670341 6:35726359-35726381 CTGGTTGGCTTTGGGAAGGCAGG + Intronic
1006944621 6:37777296-37777318 GGGCTGGGCTTGAGGATGGAAGG - Intergenic
1007566310 6:42853494-42853516 CTGCTTGCTGTGAAGAAGGAGGG - Intronic
1010011910 6:71057697-71057719 ATGCTAGGCTTGATGAAGAATGG + Intergenic
1010758532 6:79695229-79695251 CTTCTTGGCTTGGTCAAGGAAGG + Intronic
1010767346 6:79791264-79791286 CAGCTTGGCTTGAGCAGGGTGGG - Intergenic
1015317615 6:131834403-131834425 CTGCTTTGCCTGGGGAAGTAAGG + Intronic
1015885346 6:137911953-137911975 CTGCTTGGCTTGAAGGGAGAAGG - Intergenic
1016395302 6:143617631-143617653 CTGCTAGACTGGAGGGAGGAAGG - Intronic
1017198186 6:151724335-151724357 CTGTCAGTCTTGAGGAAGGAGGG - Intronic
1018194530 6:161343562-161343584 TCGTTTGGCTTGAGGGAGGATGG + Intergenic
1019282792 7:208883-208905 CTTCATGGCTGCAGGAAGGAGGG - Exonic
1019609336 7:1929081-1929103 CTGCTCGGCCTCAGGGAGGAGGG - Intronic
1020348312 7:7188606-7188628 CTGGGTGGCATGAGCAAGGAAGG - Intronic
1020901458 7:14008516-14008538 CTTTTTGGAATGAGGAAGGAGGG + Intergenic
1020951557 7:14685259-14685281 CTGATTGGCGTGGGGAAGCAGGG - Exonic
1022921455 7:35019911-35019933 CTACTCGGCTGGAGGAAGTAGGG + Intronic
1023659422 7:42457226-42457248 CTGGGTGGCTTCAGGAAGGAAGG + Intergenic
1026639452 7:72111357-72111379 CTGCTTCCCTTTAGGGAGGAGGG - Intronic
1027651093 7:80869796-80869818 CTTTTTGGTTTGAGGAATGAGGG - Intronic
1029032844 7:97487226-97487248 CTTCTTGGCAAGAAGAAGGATGG - Intergenic
1029441936 7:100591652-100591674 CTTCGTGTCTGGAGGAAGGAAGG - Exonic
1030360829 7:108593880-108593902 CTTCTTGGCAGGAGGTAGGATGG + Intergenic
1030634336 7:111931515-111931537 CTGATTAACTTCAGGAAGGAAGG - Intronic
1032112852 7:129091540-129091562 TAGCTTGGCTTGGGGCAGGAGGG + Intergenic
1032424226 7:131807788-131807810 CAGCTGGGCTTATGGAAGGAAGG - Intergenic
1032696915 7:134345090-134345112 CTTCTTGGTTTCAGGAAGGTGGG + Intergenic
1032981874 7:137293348-137293370 CTGCTTGGGAGGTGGAAGGATGG - Intronic
1033259134 7:139827093-139827115 ATGCTTGGCTAGAGGAGAGAGGG - Intronic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1035622411 8:1043879-1043901 CTGCTGGGCTCCAGGAAGGCAGG + Intergenic
1035817589 8:2557769-2557791 CTTGCTGGCTTGAAGAAGGAGGG - Intergenic
1036653734 8:10662344-10662366 CTTCTTTGGTTGTGGAAGGATGG - Intronic
1037606331 8:20440752-20440774 ATGCTGGGTTTAAGGAAGGATGG + Intergenic
1037645567 8:20789793-20789815 CTGCGGGGATTCAGGAAGGAGGG - Intergenic
1038087582 8:24216870-24216892 ATGCGGGGCTTGAGGAAGGGAGG + Intergenic
1040408812 8:47134469-47134491 GTGCTTGGCATGAGTAAGGAGGG + Intergenic
1040646618 8:49404170-49404192 GAACTTGGCTTGAGTAAGGAAGG + Intergenic
1041579393 8:59439890-59439912 CTGCTTATCTTGAGAAGGGAAGG + Intergenic
1042564705 8:70100294-70100316 CTGATTGGCAGGAGGAAGTAGGG - Intergenic
1048577157 8:135701865-135701887 CAGCTTGGCTTGGGGATGGGTGG + Intergenic
1049253287 8:141600750-141600772 CTGGCTGGCCTGAGGAGGGAGGG + Intergenic
1049396951 8:142405318-142405340 CTGCTTCTCTGGAGGAAGGAGGG - Intergenic
1050189755 9:3012442-3012464 CTGCCAGGGTTGAGGGAGGAAGG - Intergenic
1052973833 9:34397921-34397943 TTGATAGGCTTGAGGCAGGAGGG - Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053346614 9:37383104-37383126 ATGCTTGCCATGAGGATGGAGGG + Intergenic
1053404504 9:37860398-37860420 CTGCTGGGGTTGAGCAAGGTGGG + Intronic
1053695356 9:40634363-40634385 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1053942351 9:43265404-43265426 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1054306600 9:63433589-63433611 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1054405342 9:64757578-64757600 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1054438966 9:65243067-65243089 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1054491440 9:65778875-65778897 GTGATTGACTTGGGGAAGGAGGG - Intergenic
1058785034 9:108378635-108378657 CTGCTTGGCTCTAGGGAAGAAGG + Intergenic
1059915121 9:119091040-119091062 CTGCTTGGATTGAGGTAGGGGGG - Intergenic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1062480329 9:136748059-136748081 CTGCTGGGCTGGAGGCTGGAGGG - Intronic
1202777800 9_KI270717v1_random:7979-8001 GTGATTGACTTGGGGAAGGAGGG + Intergenic
1185873239 X:3681789-3681811 TTGCTGGGCTTGAGGAAGAGAGG - Intronic
1187111652 X:16307859-16307881 CTTCCTGGCTTGAAGATGGAGGG + Intergenic
1187421004 X:19133660-19133682 CTGTTGGGTTTGGGGAAGGAGGG - Intergenic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1190391330 X:49934784-49934806 GTGCTTGTCTTTGGGAAGGAGGG - Intronic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1195465752 X:105176850-105176872 CTGCTTGAGATGATGAAGGAGGG + Intronic
1196061436 X:111411840-111411862 CTGCTTGCCTTGAGGAGGTGGGG - Intronic
1197702032 X:129606773-129606795 GTGCTTGGCTTGGGGGAGGCAGG - Intergenic
1199074033 X:143510108-143510130 CTGCTTGGGAAGGGGAAGGAAGG - Intronic
1199977796 X:152904620-152904642 GTGCGTGCCTTGAGAAAGGACGG + Intergenic
1200780335 Y:7209897-7209919 CTGCTGGCCCTGAGGAAGGTGGG + Intergenic
1200791063 Y:7299324-7299346 TTGCTGGGCTTGAGGAAGAGAGG + Intergenic
1201193139 Y:11466257-11466279 GTGATTGACTTGGGGAAGGAGGG + Intergenic