ID: 1052993976

View in Genome Browser
Species Human (GRCh38)
Location 9:34539846-34539868
Sequence CCCGTAGGGTACCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 2, 1: 9, 2: 16, 3: 13, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052993965_1052993976 22 Left 1052993965 9:34539801-34539823 CCGGACATGGTGGTGCATGCCTG 0: 250
1: 5238
2: 17261
3: 48995
4: 100092
Right 1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG 0: 2
1: 9
2: 16
3: 13
4: 75
1052993970_1052993976 -8 Left 1052993970 9:34539831-34539853 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG 0: 2
1: 9
2: 16
3: 13
4: 75
1052993969_1052993976 3 Left 1052993969 9:34539820-34539842 CCTGTTGGGGACCAGCCTCAACA No data
Right 1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG 0: 2
1: 9
2: 16
3: 13
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052993976 Original CRISPR CCCGTAGGGTACCTGAAGTC TGG Intergenic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
905927694 1:41763492-41763514 GCTGTAGGGGACATGAAGTCAGG - Intronic
909177218 1:72376560-72376582 CCAGCAGAGTACCTGAAGTATGG - Intergenic
912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG + Intergenic
913243642 1:116852390-116852412 CCCGTGGGTTACGTGAAGGCTGG - Intergenic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
917852451 1:179077078-179077100 CCCGTGGGTCACCTGAGGTCGGG + Intergenic
917872090 1:179250937-179250959 CCCGTGGGTCACCTGAGGTCAGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1063522125 10:6750650-6750672 ACCCTAGAGAACCTGAAGTCAGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1070668865 10:78364139-78364161 CCCGCAGGGTCTCTGAAGGCTGG - Intergenic
1074931026 10:118126375-118126397 CTTGTAGTGTACTTGAAGTCAGG + Intergenic
1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG + Intronic
1085046361 11:73356039-73356061 CCCCTAGGGACCCTGATGTCAGG - Intronic
1091583874 12:1805135-1805157 CCCGTGGGCTGCCTGAACTCTGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1101765663 12:107696771-107696793 TCCTTAGCCTACCTGAAGTCTGG - Intronic
1102181515 12:110916106-110916128 CCCGTGGGTTACTTGAGGTCAGG + Intronic
1102443896 12:112986639-112986661 CCATTAGGGAACCTGAAGACAGG - Intronic
1102692075 12:114769291-114769313 GCGGGAGGGTACCTGAGGTCAGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1123911451 15:24972026-24972048 CCGGCAGGTCACCTGAAGTCAGG + Intronic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134563940 16:15234995-15235017 CGAGTAGATTACCTGAAGTCAGG + Intergenic
1134738554 16:16521701-16521723 CGAGTAGATTACCTGAAGTCAGG - Intergenic
1134928946 16:18190459-18190481 CGAGTAGATTACCTGAAGTCAGG + Intergenic
1141772826 16:86101411-86101433 CCTGTAGGTTACCTGCGGTCCGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1151029135 17:70715281-70715303 CCGGTGGGTCACCTGAAGTCAGG + Intergenic
1155159714 18:23185608-23185630 TCCTTAGGGTACCTGAAGGAGGG + Intronic
1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG + Intronic
1160508034 18:79438081-79438103 CCCGGAGGAGACCTGGAGTCCGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG + Intergenic
1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG + Intergenic
1163782460 19:19257663-19257685 CCCCTGGGGTCCCTGAAGACTGG - Exonic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165509406 19:36257458-36257480 CCCGTAGGGGTCCTGCCGTCAGG - Intergenic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167427336 19:49436268-49436290 CCCCTAGGGAACCTGATGTTGGG + Intronic
1167800904 19:51741091-51741113 CAGGTAGGTTACCTGAGGTCAGG - Intergenic
933521896 2:83384360-83384382 CCCTTAGGGTCCCTGGAGTGAGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
938183665 2:129208020-129208042 CGGGTAGATTACCTGAAGTCAGG + Intergenic
942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG + Intronic
946305733 2:218855986-218856008 CCCGCAGCCCACCTGAAGTCAGG - Intergenic
1179250320 21:39666519-39666541 CACGTAGATTACCTGAGGTCAGG - Exonic
1181487118 22:23238478-23238500 CCCCCAGGATACCTGAAGTTGGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949571404 3:5297044-5297066 CCCATTGGGTACCTGTTGTCTGG - Intergenic
949777716 3:7651126-7651148 CCCTTTGGGTCCCTGAACTCTGG - Intronic
951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG + Intronic
953319421 3:41958998-41959020 CAGGTAGGTCACCTGAAGTCAGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
959012108 3:101089612-101089634 CCCGTAGGGTATTTAAAGTTTGG - Intergenic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
968791687 4:2669068-2669090 CGGGTAGGTCACCTGAAGTCAGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
970674305 4:18431412-18431434 CGGGTAGATTACCTGAAGTCAGG - Intergenic
972891475 4:43561416-43561438 CAGGCAGGTTACCTGAAGTCGGG + Intergenic
974620032 4:64341959-64341981 CTCGAAGGGAAACTGAAGTCAGG - Intronic
977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG + Intergenic
978470200 4:109057507-109057529 CCGGCAGGTCACCTGAAGTCAGG - Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
985504406 5:270937-270959 CCAGTGGATTACCTGAAGTCGGG - Intergenic
987598249 5:20030033-20030055 CCCGGAGGCTACCTGAACTTTGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
1003820683 6:9893396-9893418 CGGGTGGGTTACCTGAAGTCAGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1010105800 6:72165861-72165883 CCAGTAGGATACCAGAGGTCAGG - Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG + Intronic
1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG + Intronic
1034612569 7:152385182-152385204 CCTGTAGAGTTCCTGTAGTCAGG - Intronic
1034820989 7:154216139-154216161 CCCGTGGGGTCCCTGGAGCCAGG - Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1041144712 8:54861827-54861849 CGGGTAGATTACCTGAAGTCAGG - Intergenic
1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1048598809 8:135896582-135896604 CCCGCAGGCTTCCTGATGTCAGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057807897 9:98233673-98233695 CATGTAGGGTGCCTGGAGTCTGG - Intronic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1060091298 9:120746311-120746333 CAGGTAGATTACCTGAAGTCAGG + Intergenic
1061313702 9:129780559-129780581 CACGTGGATTACCTGAAGTCAGG + Intergenic
1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG + Intergenic
1187647178 X:21360495-21360517 CTCTTAGGGTACCAGATGTCTGG - Intergenic
1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1192705538 X:73526067-73526089 CCTGTAGGATCCCTGAAGCCAGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1200706551 Y:6447819-6447841 CCTGAAGGGTCCCTGAGGTCGGG - Intergenic
1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic