ID: 1052994524

View in Genome Browser
Species Human (GRCh38)
Location 9:34544124-34544146
Sequence CAGAAGAGGGAGAGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052994519_1052994524 -5 Left 1052994519 9:34544106-34544128 CCTCAGGGGTGGCAGAGGCAGAA 0: 6
1: 9
2: 22
3: 101
4: 864
Right 1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052994524 Original CRISPR CAGAAGAGGGAGAGGAAGGC AGG Intergenic
No off target data available for this crispr