ID: 1052994602

View in Genome Browser
Species Human (GRCh38)
Location 9:34544863-34544885
Sequence CTGAATATTCAGATTGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052994602_1052994606 -7 Left 1052994602 9:34544863-34544885 CCCCTTTCAATCTGAATATTCAG No data
Right 1052994606 9:34544879-34544901 TATTCAGTTCTTTCATTTCAGGG No data
1052994602_1052994607 -6 Left 1052994602 9:34544863-34544885 CCCCTTTCAATCTGAATATTCAG No data
Right 1052994607 9:34544880-34544902 ATTCAGTTCTTTCATTTCAGGGG No data
1052994602_1052994605 -8 Left 1052994602 9:34544863-34544885 CCCCTTTCAATCTGAATATTCAG No data
Right 1052994605 9:34544878-34544900 ATATTCAGTTCTTTCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052994602 Original CRISPR CTGAATATTCAGATTGAAAG GGG (reversed) Intergenic
No off target data available for this crispr