ID: 1052995382

View in Genome Browser
Species Human (GRCh38)
Location 9:34549306-34549328
Sequence CTGGCTCCCCAGAACCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052995379_1052995382 -4 Left 1052995379 9:34549287-34549309 CCGATGTCTGCACTTATGCCTGG No data
Right 1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG No data
1052995378_1052995382 3 Left 1052995378 9:34549280-34549302 CCAATGACCGATGTCTGCACTTA No data
Right 1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG No data
1052995377_1052995382 21 Left 1052995377 9:34549262-34549284 CCAGATTCTGTTTTAACTCCAAT No data
Right 1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052995382 Original CRISPR CTGGCTCCCCAGAACCACCA TGG Intergenic
No off target data available for this crispr