ID: 1052998358

View in Genome Browser
Species Human (GRCh38)
Location 9:34563873-34563895
Sequence CACTCTGAGTGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998358_1052998365 24 Left 1052998358 9:34563873-34563895 CCTGCCTCCCTCCACTCAGAGTG 0: 1
1: 1
2: 3
3: 21
4: 304
Right 1052998365 9:34563920-34563942 GATGTCACTGCCCAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998358 Original CRISPR CACTCTGAGTGGAGGGAGGC AGG (reversed) Intronic
900087131 1:904098-904120 CACTCAGAGTGGAGGATGGGAGG + Intergenic
900089264 1:912573-912595 CATTCTGACTGGAGGGATCCAGG + Intergenic
900331228 1:2135640-2135662 CACTCTGGATGCAGGCAGGCTGG - Intronic
900665349 1:3811357-3811379 CCCTCTGACTGCAGGGAGGAAGG - Intergenic
900697503 1:4021367-4021389 CAGGCTGAGTGGGGAGAGGCAGG - Intergenic
901263357 1:7890174-7890196 CACTCTTAATGGAGGGAGGAGGG - Intergenic
902301723 1:15506869-15506891 CACTATCTGTGGAGGGAGACAGG - Intronic
902754271 1:18538935-18538957 CACTCTGAGTGCTGTGAGGGAGG - Intergenic
905668205 1:39775120-39775142 CACCTTGAGTGGTGGGTGGCTGG - Intronic
906208509 1:43999584-43999606 AAGTCTCAGTGGTGGGAGGCAGG - Intronic
906797940 1:48712305-48712327 CACGCTGGGAGGAGGGAGACAGG + Intronic
908666273 1:66494512-66494534 GACTCAGAATGGAAGGAGGCTGG - Intergenic
909673105 1:78211244-78211266 CATTGAGAGTGGATGGAGGCAGG + Intergenic
910206265 1:84751725-84751747 GACTCTGAGGGGTGGGAGGGTGG + Intergenic
911902587 1:103524931-103524953 GATTCTGAATGGAGTGAGGCAGG - Intergenic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
913360348 1:117973823-117973845 GACTCTGAAAGGAGGGAGGAAGG - Intronic
915147280 1:153802586-153802608 GACTCAGAGTGGAGGGAAGCTGG + Intergenic
917163619 1:172086301-172086323 CAGTCTGATTGGACGGAGCCTGG + Intronic
917958618 1:180125338-180125360 ACGTCTGAGTGGTGGGAGGCAGG + Intergenic
918472266 1:184886268-184886290 CACACTCAGGGTAGGGAGGCGGG + Intronic
919980330 1:202638880-202638902 CCCTCTGAGAGGAGAGAGGAGGG - Intronic
920852882 1:209640592-209640614 CACAGTGAGTGGTGGGAGGTGGG - Intronic
921023869 1:211259810-211259832 GGCTCTGAGGGGAGGGAGGGCGG - Intronic
921566541 1:216728488-216728510 AACTCTGAGAGGAAGGTGGCGGG + Intronic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922343621 1:224677736-224677758 CTGTCTGAGTGCAGGGAGGTGGG - Intronic
922748122 1:228058638-228058660 CAGTCAGAGTGCAGGGATGCAGG - Intronic
923007858 1:230066886-230066908 CACGCTGAGGGGCGGGCGGCCGG + Intronic
923631363 1:235650641-235650663 CACTCCGGGGGGAGCGAGGCCGG + Intronic
1062891742 10:1066859-1066881 CATTCTGCGTGGATGGCGGCAGG + Intronic
1063534312 10:6868235-6868257 CACTCAGAGTTGAAGGAGGCTGG + Intergenic
1065759457 10:28968436-28968458 CAATCTGGGTGGAGGGAGAATGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070564689 10:77594738-77594760 CCATCTAACTGGAGGGAGGCTGG - Intronic
1071276706 10:84062090-84062112 TACACTGATTGGAGGTAGGCTGG + Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1075046678 10:119151760-119151782 CACTCTGAGGGGTCTGAGGCAGG - Intronic
1075092045 10:119449288-119449310 CGCCCTGAGTGGAGGCAGGTGGG + Intronic
1075786967 10:125056712-125056734 CACTCTTAGTCGAGGGATGTTGG + Intronic
1075972183 10:126664213-126664235 CGCTCTGAGTGTGGGGAAGCAGG + Intronic
1076472136 10:130726546-130726568 CACTCTGAAAAGAGGGAGACAGG + Intergenic
1076488637 10:130840615-130840637 CACTCTGAGGGTGGGGAGGAGGG - Intergenic
1076772830 10:132676405-132676427 CACCCGGAGTGGAGGGAGACAGG - Intronic
1076799861 10:132815866-132815888 CAGTCTGGGAGGAGGTAGGCTGG + Intronic
1077415635 11:2423093-2423115 CCCCCTGAGGGGAGGGAGGTGGG - Intergenic
1078432056 11:11295625-11295647 CTCTCAGGGTGGAGGGAGGTGGG + Intronic
1078864921 11:15288576-15288598 TACTTTGACTGTAGGGAGGCAGG + Intergenic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1081868185 11:46371221-46371243 GTCTCTGGGTGGAGAGAGGCTGG + Intronic
1083306021 11:61762420-61762442 CTCTCTGAGAGAAGGGAAGCCGG - Intronic
1083765987 11:64841924-64841946 GACTCAGAGTGCAGGGAGGGAGG + Intronic
1083891980 11:65600037-65600059 CAGTCCCAGTGGAGGCAGGCTGG + Intronic
1084122518 11:67077814-67077836 CTATCTGGGAGGAGGGAGGCGGG + Intergenic
1084751417 11:71206500-71206522 CTCTCTGCGTGGATGTAGGCTGG - Intronic
1085872995 11:80372306-80372328 CACTCTTAGTGGAGGTCGGGGGG + Intergenic
1087517016 11:99176793-99176815 CATACTGAGTGGTGGCAGGCAGG - Intronic
1089004909 11:115083395-115083417 AGCTCTGCATGGAGGGAGGCAGG - Intergenic
1089241746 11:117087192-117087214 CACTCTGAGAGGCTGGGGGCGGG + Intronic
1089339743 11:117749307-117749329 CTCTCTGAATGGGGAGAGGCAGG - Intronic
1089572270 11:119418609-119418631 CACTGTGGGTGGAGGCAGGGAGG + Exonic
1090403914 11:126466122-126466144 CACGCTGGGTGCAGGGAGGAGGG - Intronic
1090668063 11:128927947-128927969 CACTCAGAGGGGAGGAAAGCGGG - Intergenic
1091661281 12:2385602-2385624 AACTAAGAATGGAGGGAGGCAGG - Intronic
1092672378 12:10878433-10878455 CAATCTGAGAGGTGGGAGGAGGG + Intronic
1093054909 12:14546472-14546494 AACTCTGGGTGGAGCTAGGCAGG - Intronic
1093462886 12:19422131-19422153 GACTCTGGGTGGAGGGGGGAGGG + Intronic
1098258825 12:68646664-68646686 CACTCCCAGTGGAGGAAGGGTGG + Intronic
1100404594 12:94262548-94262570 CACTCTGAGTGGTGAGGGGGCGG + Intronic
1102216066 12:111162227-111162249 CACTTCCAGTGGAGGAAGGCAGG - Intronic
1102406180 12:112676199-112676221 AACACCGAGAGGAGGGAGGCAGG + Intronic
1102637205 12:114334901-114334923 CACTATGAGGGGACTGAGGCGGG - Intergenic
1103174047 12:118846327-118846349 CACTCTTAGTGGAGGGACATTGG - Intergenic
1103739573 12:123082120-123082142 CACTCTGAGTGGGTGGAGAGAGG - Intronic
1103945765 12:124525540-124525562 CAATCTGGCTGCAGGGAGGCAGG + Intronic
1105717562 13:23082244-23082266 CACTGAGAGTGCAGGAAGGCAGG - Intergenic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1108460160 13:50657687-50657709 CACTCTGTGTGGAAGTAAGCCGG - Intronic
1109118685 13:58425762-58425784 CACTTTGAGGGGGGCGAGGCAGG - Intergenic
1110143441 13:72159769-72159791 CACTCTGAGGGAAGGGAAGATGG - Intergenic
1110411971 13:75214578-75214600 CCCTCTGCATGGAGGAAGGCTGG - Intergenic
1113114168 13:106857280-106857302 AACTCTGATTGGACAGAGGCCGG + Intergenic
1113485348 13:110648874-110648896 CAATCTGCGAGAAGGGAGGCGGG + Intronic
1113694311 13:112333095-112333117 CTCTCTGTGTGGGGGGAGGGTGG - Intergenic
1114207229 14:20583640-20583662 CTCTCTGTGTGGGGGGAGGGTGG - Exonic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1116846407 14:49868296-49868318 AACTGGGAGGGGAGGGAGGCGGG + Intergenic
1118611186 14:67541651-67541673 CACACTGAGCTGAGGAAGGCAGG + Intronic
1118745663 14:68771231-68771253 GACTCTCAGTGCAGAGAGGCAGG - Intergenic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1120166469 14:81206835-81206857 CATTCTTAGTGGAGAGAGGGAGG - Intronic
1120866955 14:89303311-89303333 CTCTCAGCATGGAGGGAGGCAGG - Intronic
1120899035 14:89559762-89559784 AACACTGAGTGGAGGGTGTCAGG + Intronic
1122462197 14:101904987-101905009 GAATCTGGGTGGAGGGAGGTGGG + Intronic
1122610971 14:102983283-102983305 CACTCTCAGGGGAAGGACGCTGG - Intronic
1124011601 15:25843628-25843650 AACTCTGAGTAGATGGAGTCTGG - Intronic
1124247685 15:28084983-28085005 CCCTTTGAGTGTAGGCAGGCAGG - Intronic
1125033250 15:35093759-35093781 TGCTCTGAGTGGTGGGAGGGTGG + Intergenic
1126713129 15:51483656-51483678 AACTCTGAGTGCAGGGAGCAGGG - Intronic
1128233542 15:66051738-66051760 AACTCAGAGGGGAGGGAGGGAGG + Intronic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130995193 15:88899567-88899589 GGCTCTGAGGGGAGGGGGGCTGG - Intronic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1133330721 16:4971702-4971724 CACTCTGAGACTAGGGAGACCGG + Intronic
1133524769 16:6593986-6594008 AACACTGGGCGGAGGGAGGCTGG - Intronic
1134067267 16:11236848-11236870 CATTATGAGAGGAGGGAGACTGG - Intergenic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1135027278 16:19008157-19008179 CACTCTGAGTGGAGACAGACAGG - Intronic
1135880079 16:26247136-26247158 ACTTCTGAGGGGAGGGAGGCTGG - Intergenic
1136405533 16:30044241-30044263 CACTCTGGGAGGTGTGAGGCAGG - Intronic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1138390873 16:56669216-56669238 TACTTTGATGGGAGGGAGGCAGG + Intronic
1138488739 16:57363789-57363811 CCCTCTGACTGCAGGGAGGGAGG - Exonic
1138489194 16:57366311-57366333 CCCTGTGAGTGGTGGGAGTCAGG + Intergenic
1138597200 16:58035349-58035371 ACCCCAGAGTGGAGGGAGGCAGG - Intronic
1140566618 16:76049663-76049685 CACTGAGAGTGGATGGAGGGAGG - Intergenic
1140703432 16:77603850-77603872 CACTTTGGGTGGAGGTAGGTAGG - Intergenic
1142242394 16:88953509-88953531 GACCCTGAGTGTGGGGAGGCTGG + Intronic
1142246809 16:88973949-88973971 CACTATCAGTGGAGGGGTGCAGG - Intronic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1143134553 17:4704210-4704232 CGCACTGAGTGAAGGCAGGCTGG + Exonic
1143449685 17:7028481-7028503 CACTCCAAGTGGAGGCTGGCAGG + Exonic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1144200922 17:12941696-12941718 CACTTTGATTGGTGAGAGGCAGG - Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1146539965 17:33685628-33685650 AATTCTGAGAGGAAGGAGGCCGG + Intronic
1146765857 17:35520914-35520936 CACTTTGAGAGAAGGGAGGATGG - Intronic
1147321912 17:39651811-39651833 CACTCTGGGAGGCGGGAGGTGGG - Intronic
1148219495 17:45851611-45851633 CACTCTGGGTGGAGACAGCCAGG - Intergenic
1151545164 17:74788426-74788448 CGCTCTCAGTGAGGGGAGGCTGG - Intronic
1153527756 18:6013956-6013978 CACTCTGAGGGCAGGCAGCCTGG + Intronic
1156246916 18:35309476-35309498 ACCTCTGAGAGGAGAGAGGCTGG + Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157436037 18:47670066-47670088 CCCTGTGAATGGAGGAAGGCAGG - Intergenic
1157916115 18:51665311-51665333 CACCATGAGTGGGGGGAGACTGG - Intergenic
1158365501 18:56730202-56730224 CATTCTGGGTGGAGAGAGGCAGG + Intronic
1158622472 18:59045035-59045057 CATTCTGCTGGGAGGGAGGCAGG + Intergenic
1158779371 18:60628318-60628340 TAGTCTGAGTGGCAGGAGGCTGG - Intergenic
1159065270 18:63562436-63562458 CATTTTGAGTGGCTGGAGGCTGG + Intronic
1160244814 18:77148832-77148854 CACTCTGTGAGGAGTGAGGGCGG + Intergenic
1161008921 19:1950745-1950767 GACACTGGCTGGAGGGAGGCAGG - Intronic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1163557731 19:18001992-18002014 CAGTCTAAGTTGAGGGAGTCTGG - Intronic
1163607348 19:18282233-18282255 CACGCGGGGTGGAGGGAGGGAGG - Intergenic
1164677612 19:30112215-30112237 CCCACTGAGGGGAGGGAGGTCGG + Intergenic
1165076228 19:33281359-33281381 GGCTCTGGCTGGAGGGAGGCTGG + Intergenic
1165330605 19:35139526-35139548 CCCCCTGAGTGGGGGAAGGCAGG + Intronic
1165395136 19:35559786-35559808 CACAGTGAGTGGGGGCAGGCGGG - Exonic
1166119106 19:40674374-40674396 GTCTCAGAGTGGAGGGAGCCAGG - Intronic
1166389712 19:42402184-42402206 CAGACGGAGTGGACGGAGGCAGG + Intronic
1166893490 19:46008793-46008815 GACTCTGAGTCCAGGGAGGGAGG + Intronic
1166896147 19:46022962-46022984 CGCTCCGAGTCGAAGGAGGCTGG + Exonic
1167468150 19:49660987-49661009 CACCCTGATGGGAGGGAGGGAGG - Intronic
1168278127 19:55288108-55288130 CACTCTTGGCGTAGGGAGGCAGG + Intronic
1168290629 19:55355307-55355329 CACTCCGAGTGGCCGGATGCGGG - Exonic
1168516717 19:57015330-57015352 CAACCTGAGTGAAGGGAGGGCGG - Intergenic
925080062 2:1056494-1056516 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925080085 2:1056566-1056588 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925080126 2:1056702-1056724 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925113787 2:1360344-1360366 CACTCTGAGGGCAGAGAGGGAGG - Intronic
925703184 2:6659350-6659372 CACCATGAGTGAAGGGAGCCTGG + Intergenic
925710133 2:6731222-6731244 CAGTCTGAGTGGGCAGAGGCTGG + Intergenic
927149494 2:20187541-20187563 CACCATGTGGGGAGGGAGGCCGG - Intergenic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
931485264 2:62684294-62684316 CTTTCTGAGTGGAGGGATGGGGG + Intronic
932877923 2:75472927-75472949 CACTCAGAGTGAAGGGAGAGAGG + Intronic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
938029935 2:127983464-127983486 CACTCAGCCTGGAGGTAGGCAGG - Intronic
941003032 2:160221351-160221373 CCCTCTGAGTGCAGGGTGGAAGG + Intronic
946650519 2:221888307-221888329 AACTTTGAAGGGAGGGAGGCAGG + Intergenic
947892991 2:233643118-233643140 CATTCTGAAGGGAGGGATGCAGG - Intronic
1172514994 20:35527304-35527326 GATGCTGAGTGAAGGGAGGCAGG - Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173461618 20:43247664-43247686 CACTCTCTGTGGAAGGAGGCAGG + Intergenic
1173641995 20:44609842-44609864 CCCTCTGAGGTGAGTGAGGCCGG - Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1175434206 20:58931191-58931213 CACAGAGAGAGGAGGGAGGCAGG + Intergenic
1175727903 20:61332050-61332072 ATCTCTGAGTGGACAGAGGCTGG + Intronic
1175889994 20:62311781-62311803 GACTCTGGGGGGCGGGAGGCCGG + Exonic
1178781178 21:35604484-35604506 CTTTCTGCGTGGAGGGAGCCGGG + Intronic
1178797316 21:35756863-35756885 GACTCTGAGTTGGGGAAGGCAGG - Intronic
1179937455 21:44614359-44614381 CACTGTGGCTGGAGGGAGCCCGG + Intronic
1181059514 22:20275495-20275517 CACTCTGAGTGAAGGTCAGCAGG - Intronic
1182017933 22:27056383-27056405 CACACTGAGTGCAGGAAGCCCGG + Intergenic
1182352294 22:29705761-29705783 CACTCTGAGCGGGGTGGGGCTGG - Intergenic
1182394930 22:30028387-30028409 CTCTCTGTGTGGAGAGAGGGCGG - Intronic
1182694011 22:32184465-32184487 CAATCTGAGTGGAGGGGTGGGGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183357380 22:37366940-37366962 AACTCTTAATGGAGGCAGGCAGG + Intergenic
1184302037 22:43567078-43567100 AACTCTGAGTGGGGGAAGGATGG - Intronic
1184412732 22:44334118-44334140 CACTCAGCGTTGAGGGATGCGGG + Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185005710 22:48275656-48275678 CACTCTGAGTGGAATGGGGCAGG + Intergenic
1185092072 22:48781249-48781271 GATGCTGAGTGGAGGAAGGCAGG + Intronic
949491401 3:4592883-4592905 GACTCTGAGTGGTGGGAGACTGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951652038 3:24961611-24961633 CACACTGTGGGGAGGGAGGGCGG + Intergenic
953675423 3:44997878-44997900 GACTCTGTGTGGGAGGAGGCAGG - Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954625007 3:52017666-52017688 CACACTGCGTGGCGGGATGCAGG - Intergenic
954991376 3:54843503-54843525 GGCAGTGAGTGGAGGGAGGCAGG + Intronic
960042803 3:113167445-113167467 CACTGAGAGTGTAGGGAGGGAGG + Intergenic
960287167 3:115842658-115842680 CAATCTGATTAGAGAGAGGCAGG + Intronic
960950897 3:122997837-122997859 CACTCTGGGTGGTGTGGGGCAGG - Intronic
961034756 3:123634654-123634676 CGCTCTGGCTTGAGGGAGGCTGG + Intronic
961132564 3:124482729-124482751 AACTCTGAGAGGAGAAAGGCAGG - Intronic
961258463 3:125579161-125579183 TTCCCTGACTGGAGGGAGGCAGG + Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962271100 3:133978683-133978705 CACTCTTCCTGGATGGAGGCAGG - Intronic
965600913 3:170453993-170454015 CACTCTGAGGGGAGAGATGGCGG - Intronic
966340608 3:178921717-178921739 CAGTCTAAGTGCATGGAGGCTGG - Intergenic
966449206 3:180038140-180038162 GACCCTGGGTGAAGGGAGGCAGG + Intergenic
966886787 3:184381378-184381400 CGCCCTGCGGGGAGGGAGGCAGG + Intronic
967812184 3:193769709-193769731 GGCTCTGATTGGAGGGAAGCAGG - Intergenic
967975914 3:195034766-195034788 CACTGTGCGTGGAGGGATGCAGG + Intergenic
969016112 4:4105518-4105540 CACTTTGAGAGGGGGAAGGCGGG - Intergenic
969596776 4:8153548-8153570 CATTCAGAGTGGAGTCAGGCAGG + Intronic
969992651 4:11279909-11279931 CCCTCTGAGTGTAGGGACCCTGG - Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971230633 4:24798345-24798367 GAGACTGAGTGGAGGGAGGGTGG - Intronic
972215367 4:36891565-36891587 CACTGAGAGTGGATGGAGGGAGG - Intergenic
974156849 4:58084290-58084312 CACTGTGAGTGGAAGAAGACTGG + Intergenic
974240952 4:59246236-59246258 CACTCTGAGAGCAGAGAGGATGG + Intergenic
975147114 4:70980618-70980640 CACTCTGTGGGGAGGGGTGCAGG - Intronic
978834257 4:113128865-113128887 CCCTCTAAGTGAAGGGAGGTAGG - Intronic
983162452 4:164433095-164433117 CACTCTTGCTTGAGGGAGGCTGG + Intergenic
985772812 5:1823787-1823809 CACTCTGAGAGGAGGGGAGGAGG - Intergenic
986040654 5:3990976-3990998 CACTCTGAGTTGAGGGAGTTTGG - Intergenic
986109549 5:4698848-4698870 TACTCTGAGTGAAAGGAGTCAGG + Intergenic
986162197 5:5240216-5240238 CACTCTTGGGGGAGGGAGGTGGG + Intronic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
987687234 5:21220286-21220308 AACTCTGGGTGGCAGGAGGCAGG - Intergenic
991572651 5:68072038-68072060 CACTTTGAGTGGAGACAGACTGG - Intergenic
992974110 5:82095207-82095229 AAGTCTGAGTGGTGGGAAGCTGG + Intronic
995931820 5:117455395-117455417 CACTCAGTGTGGAGAGAGGAAGG + Intergenic
996050454 5:118926384-118926406 GACTCTGGGTGGAAGGAGGGAGG + Intronic
998169080 5:139861642-139861664 CACTCTGACTGCTTGGAGGCAGG + Intronic
998988521 5:147789237-147789259 CATTCTGAGTGGATAGAGGAAGG - Intergenic
999098180 5:148999889-148999911 CACTCTGAGTGCAGTGAGGCTGG - Intronic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
1000161105 5:158598530-158598552 CACTCAGAGGGGAGGGTGTCAGG - Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1002426720 5:179181025-179181047 CACTCCGAGGGGGTGGAGGCAGG + Intronic
1002808747 6:604730-604752 GTGGCTGAGTGGAGGGAGGCAGG - Intronic
1002808765 6:604808-604830 GCGGCTGAGTGGAGGGAGGCAGG - Intronic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007135514 6:39517490-39517512 TTCACTAAGTGGAGGGAGGCAGG - Intronic
1007174304 6:39885663-39885685 CCCACTGAGTGAGGGGAGGCAGG - Intronic
1007253870 6:40515185-40515207 CACTCTGAGTAAAGGGGGGAAGG + Intronic
1007353595 6:41293992-41294014 CACTGAGAGTGGATGGAGGGAGG + Intergenic
1007422632 6:41728768-41728790 CACTGTGCGGGGAGGGAGACAGG + Intronic
1008680552 6:53867310-53867332 CCCTCTGAGTGCAGTGAGGCTGG + Intronic
1008899439 6:56594904-56594926 CACTCTGAAGGCAGGAAGGCAGG + Intronic
1011315732 6:86028605-86028627 CTCTCAGAGTGGAGAGTGGCAGG + Intergenic
1012616051 6:101281479-101281501 CACCCTACCTGGAGGGAGGCTGG - Intergenic
1012803700 6:103868635-103868657 CACCATGTGTGGAGGGAGGGAGG - Intergenic
1017261175 6:152389565-152389587 TACTCTGAGAAGAGGGAGGTAGG + Intronic
1017590931 6:155977276-155977298 CACTCTGGGGGGGGCGAGGCAGG - Intergenic
1017971343 6:159315168-159315190 CACCCTGAGCTCAGGGAGGCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018646143 6:165950548-165950570 CACTCTGTGTGCAGGGAAGAAGG - Intronic
1018650568 6:165988488-165988510 CGCTCTGCCTGGAGGGAGGCTGG + Intergenic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1018858036 6:167689376-167689398 CACTCTCAGTGGAGGCAGCACGG + Intergenic
1018908235 6:168087580-168087602 AGCTCTGAGTGGTGGGAGGAGGG - Intergenic
1019147741 6:169985755-169985777 CACTCAGAGTGGAAGCATGCAGG - Intergenic
1019706637 7:2500050-2500072 CACTCTGAAAGAAGGGAGCCAGG - Intergenic
1020197025 7:6048601-6048623 CACACTCAGTGGCGAGAGGCAGG + Intronic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1022451580 7:30520807-30520829 CAGCCAGAGTGGAGAGAGGCAGG + Intronic
1022509464 7:30925942-30925964 AAATGTGAGTGGAGGGAGGGAGG - Intergenic
1023221580 7:37924415-37924437 CATTCTGAGTGGAAGGGGTCAGG - Intronic
1023999270 7:45180232-45180254 CACCCTGGGTGGAGGCAGCCTGG + Intronic
1026442500 7:70456694-70456716 CACAGTGAGTGGAGCCAGGCTGG - Intronic
1026568877 7:71512249-71512271 CACTTTGGGAGGAGTGAGGCGGG - Intronic
1026954986 7:74371497-74371519 CACACTGCCAGGAGGGAGGCGGG + Intronic
1027902696 7:84137506-84137528 CACTCTGAGTTGTGTGAGGATGG + Intronic
1027947326 7:84765423-84765445 GACTCTGAAAGTAGGGAGGCAGG - Intergenic
1031234476 7:119156397-119156419 CTCTCAGAGTGGAGGGTGGGAGG + Intergenic
1032334948 7:131016710-131016732 CACTCTGAGTGTGGGGATACCGG + Intergenic
1033807134 7:144967356-144967378 CACTCTGTGTGTGGGGAGGTGGG - Intergenic
1034395432 7:150820945-150820967 CACTGTGGGTTGGGGGAGGCAGG - Intergenic
1034674262 7:152881192-152881214 CACACTGGGTGGGGGGAGGGGGG + Intergenic
1034846384 7:154450148-154450170 CACACTAAGTGAAGGAAGGCTGG + Intronic
1035046583 7:155971773-155971795 CACGCTGAGTGGAAGGAGAGAGG + Intergenic
1035679550 8:1477941-1477963 CATTTTCAGTGGTGGGAGGCAGG + Intergenic
1036001747 8:4612697-4612719 CACTCTCAGGGTATGGAGGCTGG + Intronic
1036212781 8:6855576-6855598 CACTCTGAGTGGCTGGAGTTAGG + Intergenic
1036504302 8:9341541-9341563 CACTCTGATTGAAGGGTGGGTGG - Intergenic
1037344629 8:17885719-17885741 CATTCTGTGTGGTGAGAGGCTGG - Intronic
1037748665 8:21665860-21665882 CACTATTTTTGGAGGGAGGCTGG - Intergenic
1039252745 8:35684573-35684595 CTCTCTCAGTGAATGGAGGCTGG + Exonic
1039400047 8:37261710-37261732 AGCCCTGAATGGAGGGAGGCAGG - Intergenic
1042803797 8:72749969-72749991 CTCTGTGAGTGTGGGGAGGCAGG - Intronic
1045988226 8:108275174-108275196 CACTCTGGGAGGAGGCAGGAGGG + Intronic
1048232821 8:132660443-132660465 CACACTGCATAGAGGGAGGCGGG + Intronic
1049219547 8:141422609-141422631 CACGCTGTGTGGATAGAGGCAGG + Intronic
1049266699 8:141671469-141671491 CACCCTGAGTGCAAGGTGGCTGG - Intergenic
1049331878 8:142058975-142058997 CACCCTGAGTGGAGGCAGCTGGG - Intergenic
1049424101 8:142530431-142530453 CACCTTGGGTTGAGGGAGGCAGG - Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049537852 8:143190219-143190241 CGCTGTAAGAGGAGGGAGGCGGG - Intergenic
1050544699 9:6700090-6700112 CAATCTTAGTGGAGGGATGGAGG + Intergenic
1051151482 9:14084579-14084601 CACTGTGAGTGGTGGGTGGCAGG + Intronic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1053151266 9:35744722-35744744 CAATGTGAGTGGAAGGGGGCAGG + Intronic
1053153500 9:35757354-35757376 CAGTCTGACTGTATGGAGGCAGG + Exonic
1055726648 9:79237463-79237485 CTCTCACAGTGGAGGGAGCCAGG + Intergenic
1057571332 9:96206382-96206404 CACTCTGGCTGGAGCGAGGAGGG + Intergenic
1058877157 9:109254264-109254286 TACTCGGAGTGGAGTGAGGCGGG - Intronic
1060372960 9:123091926-123091948 CCTAGTGAGTGGAGGGAGGCAGG + Intronic
1061847314 9:133394960-133394982 CACTCTGGCTGCAGGGAGGCAGG + Intronic
1185799186 X:2994246-2994268 CACACTCAGTGCAGGGAGCCAGG - Intergenic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1190329128 X:49224983-49225005 TACTCTGTGGGGAGAGAGGCAGG + Exonic
1193348223 X:80429049-80429071 CAGTCTGAGTTGATGGAGCCGGG + Intronic
1193882220 X:86936926-86936948 CATTCAGAGTGGATGGAGGGAGG - Intergenic
1195790551 X:108580244-108580266 TACTAAGAGTAGAGGGAGGCAGG - Intronic
1198619319 X:138488901-138488923 CACCTTGAGTGGAGGCAGGCCGG + Intergenic
1198995147 X:142566298-142566320 CACACTGAATGGAAGGAGACAGG - Intergenic
1199161956 X:144623377-144623399 AAGTCAGACTGGAGGGAGGCAGG + Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1200053567 X:153447005-153447027 CACTGTGAGAGGTGGGAGGCCGG - Intronic
1200252272 X:154559982-154560004 CAGTCTCAGTGGAGGGGGTCAGG - Intronic
1200265496 X:154644434-154644456 CAGTCTCAGTGGAGGGGGTCAGG + Intergenic