ID: 1052998471

View in Genome Browser
Species Human (GRCh38)
Location 9:34564411-34564433
Sequence CTGGACTCAGTGGGTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998458_1052998471 25 Left 1052998458 9:34564363-34564385 CCCAAGACCTCCACGGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 106
Right 1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1052998460_1052998471 24 Left 1052998460 9:34564364-34564386 CCAAGACCTCCACGGGGGTGGGA 0: 1
1: 0
2: 1
3: 18
4: 141
Right 1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1052998461_1052998471 18 Left 1052998461 9:34564370-34564392 CCTCCACGGGGGTGGGATGTGTG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1052998464_1052998471 15 Left 1052998464 9:34564373-34564395 CCACGGGGGTGGGATGTGTGGGC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998471 Original CRISPR CTGGACTCAGTGGGTAAGAC TGG Intronic
901698185 1:11026689-11026711 CTTGAGTCAATGGGTAAGGCTGG + Exonic
902683304 1:18058874-18058896 CAGGACTCAGTGGGCATGAGGGG + Intergenic
905058874 1:35122119-35122141 CTGGACTCAGAGTCTAAGTCAGG - Intergenic
905172690 1:36118487-36118509 CTGGGGTGAGTGGGTAAGCCAGG + Intronic
905750338 1:40457059-40457081 CTGGTCTCAGTGGGTAAGGATGG + Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907964233 1:59313793-59313815 GGGGACTCAGTGGGAAAGAGCGG + Intronic
910147474 1:84099037-84099059 TTGGAGTCAATGGCTAAGACAGG + Intronic
913445577 1:118947147-118947169 CTGGACACAGTGAGTAAGTGAGG + Intronic
916590933 1:166189490-166189512 CCAGACTCAGTGGGTAAGGGAGG - Intergenic
917370039 1:174283123-174283145 CTGGACGCAGTGGCTCACACTGG + Intronic
917897693 1:179507906-179507928 CTGGATTCAGAGGGTTAGAATGG - Intronic
917919102 1:179734869-179734891 CTGGCCTCATTAGGTAAGAGAGG + Intergenic
919483144 1:198113883-198113905 CTGGACTCAGCTGGGAAAACTGG + Intergenic
921049880 1:211503733-211503755 CTGAACTCAGAGGGTAAGCCAGG - Intergenic
923038679 1:230303659-230303681 CTGGACTCACTGAGGAAGAGAGG - Intergenic
924026411 1:239837785-239837807 CTATACTCAGTGGTTAAGATAGG - Intronic
1062851038 10:743627-743649 CTGCATTTAGTGGGAAAGACAGG - Intergenic
1063440617 10:6069969-6069991 CTGGAAGCAATGGGTAAGAATGG - Intergenic
1063858812 10:10286048-10286070 ATGAACTCAGTGGGTAAATCAGG - Intergenic
1064844364 10:19634609-19634631 CTGGATTCTGTTGGTAAGAAAGG + Intronic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1069790040 10:71013603-71013625 CTGACCTCAGTGGGGAAGTCAGG + Intergenic
1071826882 10:89334191-89334213 CTGGAGTCTGTGGGCAAGACAGG + Intronic
1073407895 10:103313874-103313896 CTACAGTCAGTGGGTGAGACAGG - Intronic
1076043330 10:127270048-127270070 CAGGACCCAGTGGATAGGACTGG + Intronic
1076427847 10:130380213-130380235 CTGGCCTCTGTGGGGAAGAGGGG + Intergenic
1076777233 10:132704601-132704623 CTCAAGGCAGTGGGTAAGACAGG - Intronic
1077112799 11:869315-869337 CTGGACTCGGTGGGGACGTCTGG + Exonic
1077413078 11:2412499-2412521 CTGGACTCAGTCCGTGATACAGG + Intronic
1077709109 11:4518061-4518083 CTGGATTCATTGGATAAGACGGG + Intergenic
1078925650 11:15872549-15872571 TTGGACACAGTGTGTAGGACTGG - Intergenic
1084693240 11:70739014-70739036 CTGGATTCAGTGAGTAGGGCTGG + Intronic
1085704641 11:78775661-78775683 CTAGCCTCAGTGGGTAAGGACGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088495217 11:110425464-110425486 CTGGAGTCAGTGGGTGAAAATGG - Intergenic
1089500447 11:118928839-118928861 CTGGAGTGAGTGGGGAAGCCAGG - Intronic
1089883925 11:121801204-121801226 CTCTACTCAGTGAGGAAGACAGG + Intergenic
1090279729 11:125445457-125445479 CTGGTCAGAGTGGGTGAGACGGG - Intergenic
1090938712 11:131368826-131368848 CTGGGCATAGTGGGTAAGGCAGG + Intergenic
1092057617 12:5521057-5521079 CTGGCCCCACTGGGTAAGTCAGG + Intronic
1093362967 12:18254930-18254952 CTGGGCTCAGTGGCTCAGGCCGG + Intronic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1102000976 12:109558043-109558065 CTGGCCTCTGAGGGCAAGACTGG - Intronic
1103038970 12:117678961-117678983 ATGGCATCAGTGGGAAAGACTGG + Intronic
1104446707 12:128839973-128839995 ATGGACACAGTAGGTAATACAGG - Intergenic
1104446714 12:128840033-128840055 ATGGACACAGTAGGTAATACAGG - Intergenic
1105024123 12:132837439-132837461 CTGAGCTGAGTGGGTAAGGCTGG + Intronic
1109264596 13:60182907-60182929 CTGGACACAGTGGCTCACACTGG + Intergenic
1112356632 13:98679069-98679091 CTGGCCTCGGTGGTTAAGAGGGG - Intergenic
1112405555 13:99117027-99117049 ATGCATTCAGTGAGTAAGACAGG + Intergenic
1115783426 14:36796885-36796907 CTGGACTCAGCGAGTAAGCCTGG + Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118386581 14:65260620-65260642 CTGGGCTCAGTGGTAAGGACAGG - Intergenic
1118751415 14:68810355-68810377 CTGTCCTCAGTGGGTGAGGCAGG + Intergenic
1121692251 14:95886234-95886256 GTGGGCTCAGTGGGTAGGAGAGG + Intergenic
1122790937 14:104183930-104183952 CTGGACTTACTGGGTGAGTCAGG - Intergenic
1125195649 15:37042855-37042877 CTGGACTCTGAGGGTCAGTCCGG - Intronic
1125361890 15:38873195-38873217 CTGGAGGCAGTGGGGAAGAAGGG - Intergenic
1127289106 15:57554575-57554597 CTGGAGTCAGTGAGTCAGGCTGG - Intergenic
1131503800 15:92998005-92998027 CTGGTCTCAGTGCTTAAGGCAGG - Intronic
1132766493 16:1537008-1537030 CTGGACTCAGTGGGGTGGCCAGG - Intronic
1133415706 16:5605432-5605454 CTGTACTCAGTAGGGAAGAGTGG + Intergenic
1134325940 16:13207697-13207719 CTTGACTCAATGGGTTAGCCAGG + Intronic
1135250151 16:20894237-20894259 CTGGACTCAGTGGCCCAGGCTGG - Intronic
1136614290 16:31387226-31387248 CTTGACTCAGTGCTTAAGAAAGG + Intergenic
1144372748 17:14607672-14607694 CTGGGCTCACTGGTTAAGAATGG - Intergenic
1146972585 17:37084797-37084819 CTTGATTCAGCGGATAAGACAGG + Intergenic
1147984423 17:44296928-44296950 CTAGAGTCAGTGGGTATAACAGG - Intergenic
1148684447 17:49493470-49493492 CTGGACTTTGTGGGTTACACAGG + Intergenic
1149430290 17:56592366-56592388 CTGGTCTCAGTGGGTGCGAGTGG - Intergenic
1151521509 17:74633722-74633744 CTGGACTCAAGGGTTTAGACTGG - Intergenic
1151693436 17:75701471-75701493 CTGGCCACAGTAGGTAAGCCTGG + Intronic
1152139553 17:78528520-78528542 CTGGAGTCGGTGCATAAGACAGG + Intronic
1152788418 17:82264439-82264461 CTGGACTCTGAGGGGAGGACAGG + Intronic
1152820506 17:82435510-82435532 CAGGGCTCAGTGAGGAAGACAGG + Intronic
1153761626 18:8337521-8337543 CTGGCCCCAGTGGGTATGAGTGG - Intronic
1154131874 18:11744075-11744097 CTGGACTCAGTGGCACAGATAGG - Intronic
1155375243 18:25150268-25150290 GGGGACTCAGGGGGTAAGGCTGG + Intronic
1157573501 18:48729199-48729221 CTGGACCCCCTGGGTAAGAGGGG - Intronic
1162235051 19:9302368-9302390 CTGGCCTCACTAGGTAAGAATGG - Exonic
1162243540 19:9379076-9379098 CTGGCCTCAGTAGGTAAGGCTGG + Exonic
1162247957 19:9418495-9418517 TTGGCCACAGTAGGTAAGACTGG - Exonic
1162253755 19:9470382-9470404 CTGTCCTCAGTAGGTAAGTCTGG - Exonic
1162260968 19:9533830-9533852 CTGGCCACAGTAGGTAAGACTGG - Exonic
1162491655 19:10995943-10995965 GTGGACAGAGTGGGTAGGACTGG + Intronic
1165636825 19:37347304-37347326 CTGGTCTCACTGGGTAAGAATGG + Exonic
1168634890 19:57988585-57988607 CTGCTCTCTGTGGGTAAGGCAGG - Exonic
1168663628 19:58185826-58185848 CTGGTCTCAGTGGGTAAGGCTGG + Intronic
925652838 2:6110039-6110061 CTGGACTGAGTGGTTCAGCCTGG - Intergenic
925734729 2:6953147-6953169 CTGGACGCAGTGGCTCACACCGG + Intronic
926704920 2:15830294-15830316 GTGGACTGAGTGGGGAAGATTGG + Intergenic
927105352 2:19819111-19819133 CTTGGCTAAGAGGGTAAGACAGG - Intergenic
927828889 2:26330925-26330947 CTTCACTCAGTGGGAGAGACAGG + Intronic
929620570 2:43350100-43350122 CTCGACTCACTGGGTAGAACAGG + Intronic
931526433 2:63160163-63160185 CTGCATTCAATGGGTGAGACAGG + Intronic
937384823 2:121419473-121419495 CTAGACACAGTGTGAAAGACTGG - Intronic
937435378 2:121875802-121875824 CTTGACTCAGTGGGTCTGAGTGG - Intergenic
937939350 2:127273127-127273149 CTAGAATCAGTGGGGAAGGCTGG - Intronic
939203616 2:139071446-139071468 GTGGACTCATTGGGCAAGAAAGG - Intergenic
939449772 2:142358421-142358443 CTGCACTCAGTGTCTGAGACTGG - Intergenic
939582436 2:143966590-143966612 CTGGGCGCAGTGGGTGAGATGGG - Intronic
944367285 2:198936799-198936821 CTGCCCACAGTGGGTGAGACTGG + Intergenic
944666247 2:201961858-201961880 CTAGCCTCAGAGGGTTAGACTGG - Intergenic
945223374 2:207506931-207506953 CAGGACTCAGTGGAGAAGTCTGG - Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
1170316545 20:15047713-15047735 CACAACTCAGTGGGTAAAACTGG - Intronic
1171517267 20:25747459-25747481 CTGGACCCAGAGGGAAGGACAGG - Intergenic
1172296456 20:33814552-33814574 CTGGAGTCTGTGGGTGGGACAGG + Intronic
1172867925 20:38113899-38113921 CTGGACTCAGAGGGAGAGGCTGG - Intronic
1175917784 20:62434963-62434985 CTGGAGTCAGTGGGGAATTCGGG + Intergenic
1176342649 21:5713160-5713182 CTGGAAACAGAGGGAAAGACAGG + Intergenic
1176474903 21:7145311-7145333 CTGGAAACAGAGGGAAAGACAGG + Intergenic
1176502178 21:7611296-7611318 CTGGAAACAGAGGGAAAGACAGG - Intergenic
1176536970 21:8111229-8111251 CTGGAAACAGAGGGAAAGACAGG + Intergenic
1179175715 21:39006438-39006460 ATGCACTCAGTGGGTCAGAAAGG + Intergenic
1181116649 22:20635848-20635870 CTGGGCTCAGTGAGTATGAGGGG - Intergenic
1184428854 22:44429282-44429304 CTGGACTCAGTGGGTCCTGCAGG + Intergenic
1203241921 22_KI270733v1_random:27633-27655 CTGGAGACAGAGGGAAAGACAGG + Intergenic
949370231 3:3326822-3326844 CTGGAGTCAGCAGGTTAGACAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952047088 3:29335724-29335746 CAGAACTCAGCGGGGAAGACAGG + Intronic
953977901 3:47396079-47396101 CAGGACTCAGAGGGCAAGGCGGG + Intronic
955517087 3:59736794-59736816 GTGGGCTCAGGGGGTTAGACAGG + Intergenic
958893169 3:99802526-99802548 CTCAACTCAGTGCGTAAGAGTGG + Intergenic
960946887 3:122973189-122973211 CTGGAGTCAGGGGCTCAGACTGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967606407 3:191452132-191452154 CTGGTCTCACTGGCTCAGACAGG + Intergenic
971392964 4:26203135-26203157 CTAGACTAAGGGGATAAGACTGG - Intronic
972618041 4:40719112-40719134 CTGGACTCCCTGTGTAACACAGG - Intergenic
974046714 4:56904764-56904786 CTGGACTCGGTGGCTTACACAGG + Intergenic
982950113 4:161683900-161683922 AGGGACTCAGGGGGAAAGACTGG - Intronic
987224433 5:15824714-15824736 CATGACTCAGTGGGTGAGACTGG - Intronic
989286777 5:39709295-39709317 CTAGAGTCCGTGGGTAACACAGG + Intergenic
989661248 5:43800048-43800070 CTAGACCCAATGGGTAAGAGAGG - Intergenic
990846808 5:60150242-60150264 ATGGACTGAGTTGGGAAGACTGG + Intronic
991111413 5:62904046-62904068 AGGAACTCAGTGGGTATGACTGG - Intergenic
995431614 5:112085464-112085486 GTGGACTCAGTGGGAAAGAGTGG - Intergenic
997105488 5:131014308-131014330 GGGGACTCAGTGGGAAAGAGGGG - Intergenic
997369650 5:133350364-133350386 CTGGACACAGAGGGGCAGACTGG - Intronic
999275922 5:150330138-150330160 CTGGGCACAGTGGACAAGACAGG + Intronic
999353267 5:150898418-150898440 CTGGTCTCAATGGGTAAGGATGG - Exonic
999356802 5:150942540-150942562 CTGGTCTCAATGGGTAAGGATGG - Intergenic
1001323065 5:170698691-170698713 CTAGAAGCAGTGGGTTAGACAGG - Intronic
1002052422 5:176578621-176578643 CTGGACCTGGTGGGTAAGGCTGG + Intronic
1003626977 6:7750038-7750060 ATGGGCACAGTGGGTGAGACAGG + Intronic
1004389900 6:15201370-15201392 CTGGGCTCAGTGTGCAATACAGG - Intergenic
1006627014 6:35404701-35404723 CTGGACTTGGTGGGAAGGACTGG + Intronic
1007715087 6:43851164-43851186 CTGGACTCTGTGGGTGCTACGGG + Intergenic
1008105307 6:47434749-47434771 CTGCATTCAGTGAGAAAGACTGG - Intergenic
1010388555 6:75310327-75310349 CTTGACTCAGTGGAATAGACAGG - Intronic
1011006138 6:82647503-82647525 CATGACTCAGAGGGTAAGGCTGG - Intergenic
1013187302 6:107770946-107770968 CAGTAGTGAGTGGGTAAGACTGG + Intronic
1014581909 6:123148098-123148120 CAAGACTGAGTGGGAAAGACAGG - Intergenic
1015235862 6:130970516-130970538 CTTCATTCAGTGGGTAAAACAGG - Intronic
1015688242 6:135890537-135890559 CAGCACGCAGTGGGTATGACTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016910753 6:149196356-149196378 CTTGCCTCAGTGGGGTAGACTGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017949722 6:159126608-159126630 CTGGACCCAGTGGGTCACTCTGG - Intergenic
1018202697 6:161410336-161410358 CTGGGCCCAGTGGGTATGAGCGG - Intronic
1020088706 7:5325172-5325194 CTGGCCTCAGAGGGCAAGGCAGG + Exonic
1020477644 7:8616983-8617005 CTGGCTTCAGTGGATAAGAAAGG + Intronic
1021743089 7:23707800-23707822 CTAGACTCAGTGTCTAATACCGG + Intergenic
1022413520 7:30158090-30158112 TTGGACTAAGAGGGTAAGAGAGG + Exonic
1025205605 7:56991942-56991964 CTGGCCTCAGAGGGCAAGGCGGG - Intergenic
1025666335 7:63584996-63585018 CTGGCCTCAGAGGGCAAGGCGGG + Intergenic
1025736898 7:64157680-64157702 TTTGACTCATTTGGTAAGACAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026048754 7:66926956-66926978 CCAAACTCAGTGTGTAAGACTGG - Intronic
1026244307 7:68604923-68604945 CTGGACTAAGTGGGTTGGACAGG - Intergenic
1026483983 7:70801939-70801961 GGGGACTCAGTGGGGAAGATTGG - Intergenic
1027187184 7:75979608-75979630 ATGGAGGCAGTGGGTAGGACAGG + Intronic
1027587962 7:80081574-80081596 ATGGAGTCAGTGGGGCAGACAGG + Intergenic
1029056584 7:97751180-97751202 CAGCACTCAGTGGGCATGACTGG + Intergenic
1030110390 7:106021720-106021742 CAGGACCCAGTGGGTCACACTGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031372692 7:120987060-120987082 TTGGACTCAGTGGTTAAAATGGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1034254914 7:149719660-149719682 CTGGTCTCTGTGGGTAAGGACGG + Exonic
1035456748 7:159013884-159013906 CTGGCCTCAGTGGGCAAACCTGG + Intergenic
1036692365 8:10951909-10951931 CTGGGCTGAGTGGGGACGACAGG + Intronic
1037596395 8:20357905-20357927 TTGGACTGAATGGGTAATACAGG - Intergenic
1038381801 8:27102541-27102563 CTGGGTTCAGTGGGTCACACTGG + Intergenic
1039404713 8:37302579-37302601 CTGGTCTCTGTGTGTGAGACTGG - Intergenic
1040370846 8:46772061-46772083 CAGCACTCAGTGGGCATGACTGG - Intergenic
1040758244 8:50807114-50807136 CAGGACTCAATTGGTAAAACTGG + Intergenic
1044378608 8:91504906-91504928 CTGGGCTGACTGGGTAAGAGGGG - Intergenic
1046625738 8:116575065-116575087 CTGGACAAAGTGAGTCAGACGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052161023 9:25259454-25259476 CAGAACTTAGTGAGTAAGACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG + Intronic
1054916500 9:70499464-70499486 CTGGGCTCAGTGGGCAAAAACGG - Intergenic
1055688706 9:78806998-78807020 TGGGACTTAGTGGCTAAGACTGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056579957 9:87883417-87883439 CTGGACTCAGTGGCAAGGACCGG + Intronic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1060123157 9:121015512-121015534 CTGGAATCAGTGGATCAGAGAGG - Intronic
1060959734 9:127671578-127671600 CTGCACCCAATGGGCAAGACAGG - Intronic
1061775184 9:132958229-132958251 CTGGATTAAGGTGGTAAGACGGG + Intronic
1061856421 9:133444120-133444142 CTGGCCTCAGCGGGGAAGAGTGG - Intronic
1203458238 Un_GL000220v1:10710-10732 CTGGAGACAGAGGGAAAGACAGG + Intergenic
1186163276 X:6800851-6800873 GTGGACTCAGCGGGCAAGTCGGG - Intergenic
1187522753 X:20027834-20027856 CTGTACCCAGTAGGTAAGAGTGG + Intronic
1189102092 X:38201443-38201465 CTGCATTCAGTAGGAAAGACAGG - Intronic
1190093039 X:47456262-47456284 CTGCTCTCAGTGGGTAAGCACGG - Exonic
1195105257 X:101597323-101597345 CTGCAGACAGTGGGGAAGACAGG + Intergenic
1195940373 X:110162615-110162637 CTACACTCAGTGGCTAAGAATGG + Intronic
1198006940 X:132504549-132504571 GGGGACTCTGTGGCTAAGACTGG - Intergenic