ID: 1052998809

View in Genome Browser
Species Human (GRCh38)
Location 9:34566041-34566063
Sequence AACTTAATTGGCTCGTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998809_1052998817 26 Left 1052998809 9:34566041-34566063 CCTGTTAACGAGCCAATTAAGTT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998809_1052998814 0 Left 1052998809 9:34566041-34566063 CCTGTTAACGAGCCAATTAAGTT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1052998814 9:34566064-34566086 GGGCCAGTGGCCTCTTAATTAGG No data
1052998809_1052998818 27 Left 1052998809 9:34566041-34566063 CCTGTTAACGAGCCAATTAAGTT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1052998818 9:34566091-34566113 TTAACACCACCAAGACTGCAGGG No data
1052998809_1052998819 28 Left 1052998809 9:34566041-34566063 CCTGTTAACGAGCCAATTAAGTT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1052998819 9:34566092-34566114 TAACACCACCAAGACTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998809 Original CRISPR AACTTAATTGGCTCGTTAAC AGG (reversed) Intronic
903486417 1:23692256-23692278 AACTTAATTGCTCAGTTAACAGG - Intronic
912362104 1:109103613-109103635 AACTTAATTGGCTGTGTAATCGG - Intergenic
924461844 1:244266587-244266609 AATTTAATTTCCTGGTTAACTGG + Intergenic
1064932677 10:20644217-20644239 AACATAATGAGCTCTTTAACAGG - Intergenic
1072522509 10:96240839-96240861 AACTTATTTAGTTCTTTAACAGG + Intronic
1075981053 10:126739691-126739713 AACTTACTCGGCTGGTTAAGAGG - Intergenic
1095398225 12:41785620-41785642 AACTTAATTGGTTCTCTAACTGG + Intergenic
1096794853 12:54070159-54070181 AACTTAATTACCTCTTTAAAGGG + Intergenic
1116555093 14:46292849-46292871 AACTTAATTGACTTGTCACCAGG + Intergenic
1117250666 14:53934316-53934338 AACTTAATCAGCTCTTTAAAGGG - Intergenic
1144300422 17:13918512-13918534 AACTAAATTGGGTCATTCACAGG - Intergenic
1158896577 18:61919541-61919563 AACTTCATAGGATAGTTAACAGG - Intergenic
932231711 2:70088608-70088630 AACTTAATTGGCTGCATAATCGG + Exonic
945177265 2:207055173-207055195 AACTTAAATTGCTGATTAACCGG + Intergenic
948405398 2:237713870-237713892 AACTTAATTGGAAAGTTAACTGG - Intronic
1178499332 21:33112757-33112779 AATTTAATTGGCTAGGAAACAGG + Intergenic
1180911254 22:19452339-19452361 AACTTAATTGCTTCTTTAAATGG + Intronic
1182374141 22:29834033-29834055 AACTTACTTGCCCTGTTAACTGG + Intronic
1183650935 22:39152837-39152859 GACTTATTTGGCTCGGTCACCGG + Intergenic
949250952 3:1983400-1983422 AACTTAGTTGGGTTGTTCACTGG - Intergenic
960807230 3:121595810-121595832 TAATTAATTGGCTGGTTAACAGG + Intronic
969257927 4:6015226-6015248 AACTTAATTGCCTCTTTGAAAGG - Intergenic
970437900 4:16053345-16053367 AAATTAGTTAGCTGGTTAACTGG - Intronic
974102619 4:57434492-57434514 ATTTTAATTGACTCTTTAACAGG - Intergenic
974318939 4:60318410-60318432 AACTTAAATGACTGGTTGACAGG + Intergenic
980037201 4:127899149-127899171 AATTTAATTGGCTCCTCAACAGG - Exonic
982660484 4:158200701-158200723 AACTCAATTGGTTTGTTTACAGG + Intergenic
983541922 4:168920288-168920310 AACTTAAATGACTGGTTAAAAGG - Intronic
994060443 5:95470541-95470563 AACATAATTGATTCTTTAACTGG + Intronic
995350794 5:111173024-111173046 AACTTAATAAGGTCTTTAACAGG - Intergenic
999589447 5:153128766-153128788 AACTTAATTTGCTTGATAATTGG - Intergenic
1014652020 6:124051618-124051640 AAGGTAATTGGCTTGTTAAAAGG - Intronic
1018538124 6:164845659-164845681 AACTTAATGGGCTCAGGAACAGG + Intergenic
1019080511 6:169426567-169426589 AACTCAATTGGCACGGTAAAGGG - Intergenic
1027645735 7:80795722-80795744 AACTTAAAAGGCACCTTAACAGG - Intronic
1036027733 8:4928757-4928779 AACTTAATTACCTCTTTAATGGG - Intronic
1041943631 8:63417275-63417297 ATCTTATTTGGCTTCTTAACTGG + Intergenic
1046367229 8:113250777-113250799 AATTTAATGGGCTTGTTTACTGG + Intronic
1051129783 9:13847411-13847433 AACTTCATGAGCTCATTAACAGG - Intergenic
1052998809 9:34566041-34566063 AACTTAATTGGCTCGTTAACAGG - Intronic
1054767935 9:69058154-69058176 GACTTAAGTGGCTTCTTAACTGG + Intronic
1055146030 9:72936062-72936084 AACTGAGTTGGCTGGTCAACTGG - Intronic
1059756447 9:117297988-117298010 AAATGAATAGGCTCCTTAACAGG + Intronic
1188131504 X:26439595-26439617 AACATAATTGGCTGGCTAATGGG - Intergenic
1188576016 X:31651139-31651161 AACTTAATTGTCTCTAAAACTGG - Intronic
1189172546 X:38923840-38923862 AACTTGATTGGCTGTTTAAATGG + Intergenic
1189474155 X:41335744-41335766 AATATAATTGGTTCATTAACGGG - Intronic
1197093442 X:122566367-122566389 AAATTAATTGGCTCATTAACTGG - Intergenic