ID: 1052998813

View in Genome Browser
Species Human (GRCh38)
Location 9:34566053-34566075
Sequence GGCCACTGGCCCAACTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998813_1052998817 14 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998813_1052998818 15 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998818 9:34566091-34566113 TTAACACCACCAAGACTGCAGGG No data
1052998813_1052998819 16 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998819 9:34566092-34566114 TAACACCACCAAGACTGCAGGGG No data
1052998813_1052998821 22 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998821 9:34566098-34566120 CACCAAGACTGCAGGGGTGTAGG No data
1052998813_1052998822 23 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998822 9:34566099-34566121 ACCAAGACTGCAGGGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998813 Original CRISPR GGCCACTGGCCCAACTTAAT TGG (reversed) Intronic
900474055 1:2868121-2868143 GGCCACTGGCCCTCCTTCTTGGG - Intergenic
902562950 1:17289400-17289422 GGCCACTGGCCCATCATGGTGGG - Intergenic
920525271 1:206661542-206661564 TCCCATTGGCCTAACTTAATCGG + Intronic
1067077621 10:43197209-43197231 GGCCACTGTCCCATCTTGCTGGG - Intronic
1072642089 10:97219448-97219470 GCCCACTGGCCCCACTTTTTTGG + Intronic
1073033589 10:100547597-100547619 GGCCACTGGCACACCTGCATGGG - Intronic
1073322409 10:102623425-102623447 GGCCACCTGCTCAACTTAAGAGG - Intronic
1076151981 10:128169806-128169828 GGACACTGGCACAAAATAATGGG - Intergenic
1086960094 11:92972570-92972592 GGGCACCGACCCAACTTAAAAGG + Intronic
1088714146 11:112534097-112534119 GGTCACTTGCCCAACTTGTTAGG - Intergenic
1098990606 12:77061362-77061384 GGACAATGCCCAAACTTAATGGG - Intronic
1103267610 12:119644161-119644183 GGCCACTGTACCAACATAAATGG + Intergenic
1114647455 14:24263562-24263584 GGCCCCTGGGCCAATTTCATAGG - Intronic
1125361438 15:38868479-38868501 GGCCACTGGCCCGACTTCCCAGG - Intergenic
1129514043 15:76145811-76145833 GGACACTGGTCCAACTGCATTGG - Intronic
1129958861 15:79664995-79665017 GGCCCCTGGCCCAATATGATGGG - Intergenic
1150104582 17:62452890-62452912 TGCGACTGGCCCCACTTAATGGG + Intergenic
928256316 2:29726020-29726042 GGTCACTGGCCCTACCTAACTGG + Intronic
928322827 2:30296680-30296702 AGCCACAGGCCCAAGTTCATGGG - Intronic
937250068 2:120518058-120518080 GGTGACTGGGTCAACTTAATTGG + Intergenic
937947109 2:127350212-127350234 GGCCACAGGCACAACTTGAAGGG + Intronic
940001312 2:148968890-148968912 TGCCACTGGGCCTATTTAATTGG + Intronic
944041267 2:195357779-195357801 GGACAATGGACCCACTTAATTGG - Intergenic
944075493 2:195725586-195725608 GCCCAGTGACCCCACTTAATAGG + Intronic
1169834481 20:9862649-9862671 GGCCACATGCCCAACTGAAAAGG + Intergenic
1182660051 22:31918810-31918832 GGCCAATGGCTCCACTTATTGGG - Intergenic
961311265 3:126003671-126003693 GGCCCCGTGCCCTACTTAATTGG + Intergenic
966219406 3:177535667-177535689 GGCCACTGGCCTAACTTCCAAGG + Intergenic
966551325 3:181207352-181207374 GGTCATTTGCCCAACTTACTGGG + Intergenic
966870293 3:184285972-184285994 GTCCACTCCCCCCACTTAATGGG - Intronic
969056839 4:4407588-4407610 GGCCACAGGACCAGCTGAATGGG - Intronic
986583681 5:9292434-9292456 AGCCACTGCCTCAACTTACTGGG - Intronic
987697181 5:21347276-21347298 AGCCACTGGCCCAAAATAAGGGG - Intergenic
988208332 5:28170264-28170286 GGCAACTGGCCCATGTTAATGGG - Intergenic
988755053 5:34239415-34239437 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991743270 5:69705101-69705123 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991754426 5:69850102-69850124 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991794843 5:70284837-70284859 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991804045 5:70406853-70406875 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991822657 5:70580412-70580434 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991833754 5:70725250-70725272 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991887220 5:71284375-71284397 AGCCACTGGCCCAAAATAAGGGG + Intergenic
1003876750 6:10444460-10444482 TCCCACTGCCCCAACTTCATGGG - Intergenic
1005553677 6:26951126-26951148 AGCCACTGGCCCAAAATAAGGGG + Intergenic
1011810000 6:91120336-91120358 GGGCACTGGATCAACTTTATAGG + Intergenic
1020533115 7:9359503-9359525 TGAGACTGTCCCAACTTAATTGG - Intergenic
1024369631 7:48565978-48566000 TGCCACTGGCCATACTTTATAGG - Intronic
1030025191 7:105316805-105316827 GCCCACTGGCCATACTTACTAGG + Intronic
1032033750 7:128506106-128506128 CGTGACTGGCCCCACTTAATGGG + Intronic
1032439570 7:131931914-131931936 GGCAACTGGCACAACTTAAATGG - Intergenic
1033717743 7:144020395-144020417 GGTCACTAGCCCAAATTGATGGG - Intergenic
1034688033 7:152990888-152990910 GGGCAATGGCACAAGTTAATGGG - Intergenic
1048860906 8:138724011-138724033 GGCCCCTGGGCCACCTTAAAGGG - Intronic
1049268487 8:141681969-141681991 GGCCACTGCCCCCACTTGAAGGG - Intergenic
1052998813 9:34566053-34566075 GGCCACTGGCCCAACTTAATTGG - Intronic
1053414607 9:37939166-37939188 TGCCACTGGCCCCTCTGAATTGG + Intronic
1062449298 9:136608884-136608906 GGGCACTGGCCCCACTTCCTGGG + Intergenic
1189892564 X:45620419-45620441 GGCCACAGGCAGAACTTGATAGG + Intergenic
1196366072 X:114925813-114925835 GCCCACTTTCCCAACTTATTGGG - Intergenic