ID: 1052998815

View in Genome Browser
Species Human (GRCh38)
Location 9:34566067-34566089
Sequence AAGCCTAATTAAGAGGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998815_1052998817 0 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998815_1052998818 1 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998818 9:34566091-34566113 TTAACACCACCAAGACTGCAGGG No data
1052998815_1052998822 9 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998822 9:34566099-34566121 ACCAAGACTGCAGGGGTGTAGGG No data
1052998815_1052998824 20 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998824 9:34566110-34566132 AGGGGTGTAGGGATCCCCCTTGG No data
1052998815_1052998825 29 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998825 9:34566119-34566141 GGGATCCCCCTTGGACCCACTGG No data
1052998815_1052998821 8 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998821 9:34566098-34566120 CACCAAGACTGCAGGGGTGTAGG No data
1052998815_1052998819 2 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998819 9:34566092-34566114 TAACACCACCAAGACTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998815 Original CRISPR AAGCCTAATTAAGAGGCCAC TGG (reversed) Intronic
906111983 1:43330257-43330279 AAGCCTCATTAGGAGGCAGCTGG + Intergenic
907315296 1:53566813-53566835 AAGCATGATTGAGAGGCCTCAGG - Intronic
909171211 1:72298448-72298470 AAGCCGAAGGAAGAGGCCTCAGG - Intergenic
912791718 1:112658455-112658477 AAGCTTGGTTAGGAGGCCACAGG - Intronic
913234110 1:116765457-116765479 AAGCCAAATCCAGAGGGCACGGG - Intronic
913484686 1:119323226-119323248 AAGTATAATTAAGAGTCCACTGG + Intergenic
924046452 1:240036911-240036933 AAAATTAATTAGGAGGCCACTGG - Intronic
924820680 1:247487499-247487521 TTGCCACATTAAGAGGCCACAGG - Intergenic
1063273986 10:4543831-4543853 AAGCTCAATTCAGAGGCAACTGG + Intergenic
1065501066 10:26382819-26382841 AAGCATAACTGAGAGGCCTCAGG - Intergenic
1066802653 10:39207875-39207897 AAGCCTTATTAGGTTGCCACAGG + Intergenic
1068217318 10:53999544-53999566 AAGCTGATTTAAGAGGCCATGGG + Intronic
1071921977 10:90360551-90360573 AAGCCTCTTTTAGAGGACACTGG - Intergenic
1075220304 10:120578893-120578915 AAGCCTGTTTGAGAGGGCACTGG - Intronic
1081225512 11:40517419-40517441 GAGGCTAATTAAGAGGACAGCGG + Intronic
1086215579 11:84375970-84375992 AAGCTTATTTAAGAGGCAAATGG - Intronic
1086223149 11:84474456-84474478 AAGGAGAATTAAGAGGCCCCAGG + Intronic
1086840121 11:91674545-91674567 AAGCCTAGGTCAGAGTCCACAGG + Intergenic
1090145567 11:124318530-124318552 ATTACTATTTAAGAGGCCACTGG - Intergenic
1090162598 11:124510867-124510889 AAGCCTGATTATGAGCCCAGAGG - Intergenic
1090499973 11:127251874-127251896 AAACATAATAAAGAGGCTACGGG + Intergenic
1092298418 12:7221678-7221700 AAGACTTAGTAAGAGGCCTCAGG + Intergenic
1093725668 12:22505497-22505519 AAGCCTCACAAAGAGGTCACTGG + Intronic
1096876209 12:54632357-54632379 AAGCCTAATGAAGAGATCTCAGG - Exonic
1103123456 12:118400210-118400232 AAGGCTCTTTTAGAGGCCACTGG - Intronic
1105721145 13:23115908-23115930 AAGCCTAAGCCAGAGGTCACTGG - Intergenic
1107985255 13:45770436-45770458 AAGGCAAATTAAAAGGGCACTGG - Intergenic
1110648461 13:77916936-77916958 AAGCCTCAGTAAGTGGGCACTGG + Intronic
1111221460 13:85209553-85209575 AAGCATAACTATGAGGCCTCAGG - Intergenic
1112928728 13:104709729-104709751 AACTCTAATTAAGAGGACATTGG - Intergenic
1114824693 14:26062775-26062797 AAGCATGACTAAGAGGCCTCAGG - Intergenic
1115302371 14:31899000-31899022 AAACATAATTAAGAGGGAACTGG + Intergenic
1118874170 14:69768461-69768483 AAACCTAATCAAGGAGCCACTGG - Intronic
1120117673 14:80638865-80638887 AAACCTAATAAAGGGGCTACTGG - Intronic
1121374940 14:93399901-93399923 AAGCTTAATTACTAGGCCACAGG + Intronic
1125992161 15:44120286-44120308 AAGATTAGGTAAGAGGCCACTGG + Intronic
1128870089 15:71148252-71148274 GAGCCCAGTTAAGAGGACACAGG + Intronic
1129443303 15:75598329-75598351 AAGCCTCCTTAAGGAGCCACAGG - Exonic
1134048921 16:11123416-11123438 AAGCCTCTTCAAGGGGCCACAGG - Intronic
1139940544 16:70602171-70602193 AAGCCTGATTGTGAGGCCAAAGG - Intronic
1146131898 17:30284488-30284510 AAGCCTAATAAAGGGCCTACTGG + Intronic
1148502052 17:48099511-48099533 AAGCTTCATTAAGGTGCCACCGG + Intronic
1151006877 17:70448231-70448253 AAGCTTAATAAAGTGGCCAAGGG - Intergenic
1153001866 18:463108-463130 AAGCCTAAGGAGGAGGCCAGTGG - Intronic
1156528455 18:37791587-37791609 AAGCAGAATAAAAAGGCCACTGG - Intergenic
1157650278 18:49322162-49322184 AAGCCAAATTATAAGGCCAAAGG - Intronic
1159985915 18:74840852-74840874 AGGACTAATTAGGAGACCACTGG - Intronic
927304624 2:21556254-21556276 CAGCCTATTGATGAGGCCACTGG - Intergenic
930424531 2:51195699-51195721 AAGCCAAATTAAGACCTCACTGG - Intergenic
930841223 2:55848007-55848029 AAACCTAATAAAGAGGACACAGG + Intergenic
932575957 2:72962517-72962539 AAGCCTGATTCAGTGGGCACTGG + Intronic
935873083 2:107472680-107472702 AAGATTAATTAATAGGACACAGG - Intergenic
935895562 2:107733829-107733851 AAGCCAAAAGAAGAGGCCTCAGG + Intergenic
937259302 2:120575316-120575338 AAGCCTGATTAACAGGACAAAGG + Intergenic
938596100 2:132788565-132788587 GAGCCTACTTAATAGGCGACTGG + Intronic
938986294 2:136579610-136579632 GAGCCTAAGGAAGAGGCCAGTGG + Intergenic
939164093 2:138621660-138621682 AAGTATAGTTGAGAGGCCACGGG + Intergenic
941659680 2:168183194-168183216 AAACCTGATGATGAGGCCACAGG - Intronic
941708356 2:168684218-168684240 AAGGCTAATGCAGATGCCACAGG + Intronic
942139407 2:172962991-172963013 AAGCATGACTAAGAGGCCTCAGG + Intronic
942485650 2:176437153-176437175 AAGCTTTATGAAGAGGCCATGGG + Intergenic
943831590 2:192471032-192471054 AAGCTTAATTAAGAGGATAAGGG - Intergenic
946561137 2:220915246-220915268 AAGCCAAATTAAGAGACAGCTGG - Intergenic
1168876551 20:1175997-1176019 AGGCATTATTAAGAAGCCACAGG - Intronic
1170213590 20:13869340-13869362 AAGCCTAAAGAAAAGGACACTGG - Intronic
1175355652 20:58365306-58365328 TAGGCCAATTCAGAGGCCACTGG + Exonic
1176273053 20:64246498-64246520 ATGCCTAAAGAAGAGGCCAGGGG + Intergenic
1177057720 21:16329322-16329344 TAGACTAATTGAGAGGCCCCAGG + Intergenic
1177347807 21:19896085-19896107 AAGCATAACTGAGAGGCCTCAGG - Intergenic
1181492903 22:23271849-23271871 AATCCTCCTTATGAGGCCACTGG - Intronic
1184972901 22:48039775-48039797 AAGTCTAATTACAAGGGCACAGG - Intergenic
954429369 3:50461829-50461851 AAGTCTAAGGAAGAGGCCATGGG + Intronic
956957516 3:74357692-74357714 TAGCCTAACATAGAGGCCACTGG - Intronic
961247021 3:125463526-125463548 ATGCCAAATCAAGAGACCACAGG + Intronic
963535115 3:146518137-146518159 AAGCCTAATTATGAAGGAACAGG - Intronic
967425400 3:189321344-189321366 ATGCTCAATTAAGAGGCCACTGG - Exonic
974355407 4:60806415-60806437 AAGCATAACTGAGAGGCCTCAGG - Intergenic
978307693 4:107349737-107349759 AATGCTAACTCAGAGGCCACAGG + Intergenic
979611962 4:122698648-122698670 ACTCCTAAGTATGAGGCCACAGG - Intergenic
980556528 4:134413212-134413234 AGGCATAATTAAGAGGCTATAGG + Intergenic
980844481 4:138307591-138307613 AAGCATGACTAAGAGGCCTCGGG - Intergenic
982253467 4:153430621-153430643 AAGGCAAATTAAGATGCCCCTGG - Intergenic
983291607 4:165814194-165814216 CAGCCTAATCAACTGGCCACTGG - Intergenic
984352439 4:178612957-178612979 AAGCATGACTAAGAGGCCTCAGG - Intergenic
984697789 4:182796932-182796954 AAGCCTGTTTAAGAGGCCTCTGG - Intronic
985371623 4:189291359-189291381 AAGCCTAGCTAGGAGGCCTCAGG - Intergenic
988575440 5:32418940-32418962 AAGACTGAGTAAGAGGCAACTGG + Intronic
989741715 5:44781231-44781253 AAGCATAAAAAAGAGCCCACAGG - Intergenic
991302950 5:65146580-65146602 AATTCTAATTAAGTGGTCACAGG - Intergenic
992768280 5:80023529-80023551 AAGCTTAAATAAGAGGAAACGGG - Intronic
995437184 5:112149858-112149880 AAGCCTAAGCAATAAGCCACTGG - Intronic
997711176 5:136006072-136006094 AATTCTAACTAAGGGGCCACGGG + Intergenic
998487558 5:142516361-142516383 AAGCCTGGTTAGGAGGCCTCAGG - Intergenic
1000783713 5:165516353-165516375 AAGCATGATTAGGAGGCCTCAGG + Intergenic
1007404159 6:41624036-41624058 AAGGATAAATAAGAGGCCACTGG - Intergenic
1007800144 6:44385351-44385373 AACCCTTACAAAGAGGCCACAGG - Intergenic
1010659898 6:78557335-78557357 AAGCATAACTAGGAGGCCTCAGG + Intergenic
1018171537 6:161147072-161147094 AAGGCTAACCAAGAGGCCAGAGG - Intronic
1018878386 6:167847732-167847754 AAGACTAAGTAAGAGGTTACTGG - Intronic
1020377766 7:7507303-7507325 AATCCTAATTAACAAGCCAAGGG + Intronic
1021012395 7:15486597-15486619 TACCATAATTAAGAGACCACAGG + Intronic
1022624370 7:32019601-32019623 TACCTAAATTAAGAGGCCACTGG + Intronic
1028056608 7:86252848-86252870 AAGACAAAATAAGGGGCCACTGG + Intergenic
1028264424 7:88705471-88705493 AAGCTAACTTAAGAGCCCACGGG - Intergenic
1030582637 7:111377625-111377647 AAGCCGAATAAATAGGCCCCTGG - Intronic
1032634882 7:133695797-133695819 AAGCATAATTCAGATGCCTCTGG - Intronic
1034328314 7:150258307-150258329 AAGCCTAAGTAAATGGCTACAGG - Intronic
1034764902 7:153711157-153711179 AAGCCTAAGTAAATGGCTACAGG + Intergenic
1035831566 8:2700192-2700214 CAGGCTAATTAAGAGGGGACTGG - Intergenic
1045936032 8:107680000-107680022 AATCCTTATCAAGAGGCCACTGG + Intergenic
1049624628 8:143614512-143614534 CAGCCTCAGTAAGAGGCCAGCGG - Intronic
1052998815 9:34566067-34566089 AAGCCTAATTAAGAGGCCACTGG - Intronic
1055793657 9:79950533-79950555 AAGTATAATAAAAAGGCCACTGG - Intergenic
1058029954 9:100184787-100184809 AGGCCTATTTAAGAGGTCATTGG + Intronic
1058590093 9:106556282-106556304 AAGACTGATCAAGAGACCACTGG - Intergenic
1058849163 9:108993891-108993913 AATCTTAATGGAGAGGCCACAGG + Intronic
1190283723 X:48948432-48948454 AAGCCTAGTGTAGAGGCAACAGG + Intronic
1192432773 X:71123786-71123808 AAGCATAATTAACAGCCCTCTGG + Intronic
1193168592 X:78310157-78310179 GAGGTTAATTAATAGGCCACTGG - Intronic
1199780276 X:151052045-151052067 AAGCATAAATCAGATGCCACTGG - Intergenic
1201900407 Y:19042446-19042468 AAGCCTAGCTAAGAGCCCGCTGG + Intergenic