ID: 1052998816

View in Genome Browser
Species Human (GRCh38)
Location 9:34566074-34566096
Sequence TGTTAACAAGCCTAATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998816_1052998821 1 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998821 9:34566098-34566120 CACCAAGACTGCAGGGGTGTAGG No data
1052998816_1052998819 -5 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998819 9:34566092-34566114 TAACACCACCAAGACTGCAGGGG No data
1052998816_1052998825 22 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998825 9:34566119-34566141 GGGATCCCCCTTGGACCCACTGG No data
1052998816_1052998822 2 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998822 9:34566099-34566121 ACCAAGACTGCAGGGGTGTAGGG No data
1052998816_1052998817 -7 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998816_1052998824 13 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998824 9:34566110-34566132 AGGGGTGTAGGGATCCCCCTTGG No data
1052998816_1052998818 -6 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998818 9:34566091-34566113 TTAACACCACCAAGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998816 Original CRISPR TGTTAACAAGCCTAATTAAG AGG (reversed) Intronic
905236282 1:36551834-36551856 TGTTAATAATAGTAATTAAGTGG - Intergenic
906994330 1:50774662-50774684 TGTTAACAAACCTAATTTACTGG - Intronic
907911812 1:58833781-58833803 TGTTGAGAAGCCTAATTAGAAGG + Intergenic
909339237 1:74512872-74512894 TGTTAACAAGCCTTATGATGGGG + Intronic
910654117 1:89602744-89602766 TGTTAACAACTCTTTTTAAGAGG - Intergenic
912285133 1:108361213-108361235 TGCTAGCAAGACTAATAAAGAGG - Intergenic
913710709 1:121480331-121480353 TGCTAGCAAGACTAATAAAGAGG + Intergenic
914736193 1:150419413-150419435 AGTTAACAATCCTAAGGAAGAGG - Intronic
915049412 1:153051930-153051952 TGCTAACTAGACTAATAAAGAGG + Intergenic
1068777764 10:60886554-60886576 TGTTAACAAGGATAAATGAGTGG - Intronic
1070852136 10:79573577-79573599 TTCTAACAAGACTAATAAAGAGG + Intergenic
1073830588 10:107378831-107378853 TTGTTACAAGCTTAATTAAGTGG - Intergenic
1079528451 11:21419040-21419062 TGTGAACAAGTGTCATTAAGGGG - Intronic
1079769031 11:24435184-24435206 TGTTTACAGGCTCAATTAAGGGG + Intergenic
1086274387 11:85108203-85108225 TGTAATAAAGCCTAATTATGAGG + Intronic
1086541391 11:87916471-87916493 TGTGAAGAAGCAAAATTAAGGGG - Intergenic
1086967620 11:93046135-93046157 TGCTAGCAAGACTAATAAAGAGG + Intergenic
1088767655 11:112999600-112999622 TGCCAATAACCCTAATTAAGAGG + Intronic
1090586511 11:128219049-128219071 TATTCACCAGCCTAATTAAGCGG + Intergenic
1092081243 12:5718233-5718255 CGTTAGCAAGCCTAAGTAAGGGG + Intronic
1092454889 12:8634281-8634303 TTTTAAAAATCCTGATTAAGAGG + Intergenic
1093047353 12:14463713-14463735 TGTTAGGAAGACCAATTAAGAGG + Intronic
1093296144 12:17394549-17394571 TGTTGACCAGCCTAAATAAAAGG - Intergenic
1098040300 12:66347441-66347463 TTTTAAAAAGCCAAATAAAGAGG - Exonic
1099873717 12:88379337-88379359 TGTCAACAAGACTATTTAATGGG - Intergenic
1099991339 12:89724702-89724724 TTTTATTAAGACTAATTAAGAGG - Intergenic
1100757483 12:97767625-97767647 TGGTAACAAGCCTTATTATTTGG - Intergenic
1105577326 13:21666340-21666362 TTTTAACAAGAAAAATTAAGGGG - Intergenic
1105933825 13:25079574-25079596 TTTTAAAAAGCCTAAATAAATGG + Intergenic
1105966208 13:25387072-25387094 TATTAACAAGGCTAAGGAAGTGG - Intronic
1108203941 13:48069478-48069500 TGCTATCAATCATAATTAAGGGG + Intronic
1110673852 13:78214970-78214992 TGTCAACAATTCTAATTTAGAGG + Intergenic
1115349249 14:32375703-32375725 TGTTAACAACCCTATTTTATAGG + Intronic
1115470955 14:33767960-33767982 TGTTAACAAGCCACATTATTTGG - Intronic
1117604654 14:57415436-57415458 TCTTAAAATGCCTATTTAAGGGG - Exonic
1118098290 14:62564807-62564829 TGTTTACAAAGTTAATTAAGAGG + Intergenic
1120134169 14:80845535-80845557 TGTCAACAATCCTAACTCAGTGG - Intronic
1120975099 14:90241482-90241504 AGTTAGCAACCCTAATAAAGAGG + Intergenic
1132560642 16:591978-592000 TGTTAACCACCTAAATTAAGAGG - Intronic
1135334702 16:21591545-21591567 TATTAAAATGCCTAATTTAGAGG + Intergenic
1135925218 16:26688038-26688060 TTTTAAGAACCCTAATTAAGGGG - Intergenic
1138734317 16:59232870-59232892 TGCTAGCAAGACTAATAAAGAGG + Intergenic
1141374016 16:83513074-83513096 TTTTCACAAGCCTAATTCTGGGG - Intronic
1141392795 16:83678552-83678574 TGTTAACAAGTTTAATTTAATGG - Intronic
1141546427 16:84773016-84773038 TGTTGACTAGCCCAGTTAAGTGG + Intronic
1143397689 17:6615462-6615484 TGCCAACATGCCTTATTAAGTGG - Intronic
1148400863 17:47359529-47359551 TTTTGTCAAGGCTAATTAAGGGG + Intronic
1150147738 17:62783623-62783645 TGCTAACAAGACTAATAAAGAGG + Intronic
1154988131 18:21573587-21573609 TCGTAATAAGCCTAATTTAGGGG + Exonic
1159184955 18:64957732-64957754 TGTTCACAATGCTAATTAATTGG - Intergenic
1159988182 18:74870320-74870342 TGATAATTAGCCTAATTAACAGG - Intronic
1166322916 19:42030060-42030082 TGTTAACCAGCTAACTTAAGGGG - Intronic
925636316 2:5944595-5944617 TGTTCAAATGCCTGATTAAGTGG + Intergenic
928287285 2:30003421-30003443 TTTTAAAAAACCTAAATAAGTGG + Intergenic
928383492 2:30842360-30842382 CTCTTACAAGCCTAATTAAGTGG + Intergenic
931417871 2:62098514-62098536 AGTTAGCAACCCTAATAAAGAGG - Intronic
932403985 2:71501367-71501389 TGTTGAGAAGCTTAAATAAGTGG + Intronic
935174312 2:100635310-100635332 TTTTAAAAAGCCTAAATAAATGG - Intergenic
939187236 2:138875622-138875644 TTTTAACAAGCCTAAGTATTAGG + Intergenic
939596679 2:144133623-144133645 TTTTAACAAAGATAATTAAGAGG + Intronic
942650993 2:178167704-178167726 TTTTAAAAAGTCTAATTAAGTGG - Intergenic
943335938 2:186614060-186614082 TGTAAACAAAGTTAATTAAGAGG + Intronic
947589158 2:231375256-231375278 TGTGAACAAGCCTAAGCCAGAGG - Intergenic
1172179609 20:32993804-32993826 TGTTAACAATTCGAATTAATAGG - Intronic
1173983672 20:47244477-47244499 TGTTAACAAGCCCAACAAAAGGG - Intronic
1177814230 21:25958574-25958596 TGTTAACATGAATAATTAATTGG - Intronic
1178516932 21:33255887-33255909 TGTTAACAAGCCTCTTTTAGGGG - Intronic
949123037 3:411037-411059 TGTTGGCAAGCATAATTAAATGG + Intergenic
949844274 3:8354087-8354109 ACTTAACAAGACTAATTAACTGG + Intergenic
956818150 3:72927660-72927682 TATTAAAAATCCTTATTAAGGGG + Intronic
959638262 3:108601119-108601141 GATTAACAAGCTTAATTAAGTGG - Intronic
960401697 3:117208189-117208211 TGCTAGCAAGACTAATAAAGAGG + Intergenic
963796524 3:149636252-149636274 TATCAACAAAACTAATTAAGTGG - Intronic
964019870 3:151996725-151996747 TTTTGACAAGCCTAGTTAGGCGG + Intergenic
966414472 3:179674822-179674844 TTTTAATATGCCTACTTAAGGGG + Intronic
966958147 3:184906531-184906553 TGTTAACATGCATAAATATGGGG + Intronic
969926031 4:10586633-10586655 TGTTATCAAGCACAATGAAGGGG + Intronic
974108525 4:57499468-57499490 TGTTTACAAGGCTTAATAAGGGG + Intergenic
974594703 4:64000257-64000279 AGTTAGCAAGCCTAATAAAGAGG - Intergenic
974627529 4:64443646-64443668 AGTTAGCAACCCTAATGAAGAGG - Intergenic
975250573 4:72173886-72173908 AGTTAGCAAGCCTAATAAGGAGG + Intergenic
976624572 4:87166124-87166146 TGTTCACATGCATAAATAAGTGG - Intronic
977898325 4:102389661-102389683 TTTTAAAAGGCCTAATTAAATGG + Intronic
981171340 4:141627120-141627142 TATTATCAAGGCTAATTTAGGGG - Intergenic
981432248 4:144674778-144674800 TTTTAAGAAGCATGATTAAGTGG - Intronic
981555482 4:145988897-145988919 TGTCAAAAAGCATTATTAAGTGG - Intergenic
981883282 4:149641893-149641915 TTTTAAAAAGGCAAATTAAGGGG + Intergenic
987289033 5:16490469-16490491 TGTTAACAATTCAAATAAAGGGG + Intronic
987445553 5:18014461-18014483 TATTAGCAAGACTAATTATGAGG - Intergenic
988880567 5:35497481-35497503 TGCTAGCAAGACTAATAAAGAGG + Intergenic
989016923 5:36947192-36947214 TGTTATCAACCCTCAATAAGTGG + Intronic
990372389 5:55133612-55133634 AGTGAAAAAGCTTAATTAAGTGG + Intronic
991180196 5:63742066-63742088 TTTTAAAAAGCCTAATTGATAGG + Intergenic
991405955 5:66301402-66301424 TGTGAACAAGACTAATACAGTGG + Intergenic
992481011 5:77152629-77152651 TGTTAACAAAGCTCATTTAGAGG + Intergenic
993305189 5:86267925-86267947 TGCTAGCAAGACTAATAAAGAGG - Intergenic
998294911 5:140959779-140959801 TATTAACATGGCTAATTTAGAGG + Intronic
998556378 5:143128543-143128565 TGTTAAGAAGCCAAATTCAGAGG - Intronic
1000583746 5:163068360-163068382 TATTAACAAACCTAAAAAAGTGG + Intergenic
1004746856 6:18518375-18518397 TGTCAACAATCCTAAATATGTGG + Intergenic
1005169258 6:22963273-22963295 TGTTAACAGGCAGTATTAAGAGG - Intergenic
1007328856 6:41087843-41087865 TGATAACACTCCTAATAAAGTGG + Intronic
1012043259 6:94237665-94237687 TGATAACAAGCCTAAATATGCGG + Intergenic
1012472088 6:99583620-99583642 TATTAACAAGCCTATTAAGGAGG + Intergenic
1014045524 6:116880956-116880978 TGGTAAGAAGCAAAATTAAGTGG + Intronic
1014380960 6:120741477-120741499 TTTTATCATGCCTAATTGAGAGG - Intergenic
1014720329 6:124909904-124909926 TGTTAACAGACCTAAATAACTGG - Intergenic
1016326414 6:142907617-142907639 TGTTAACAAGCCTCCTTTTGGGG + Intronic
1020695317 7:11406736-11406758 TGTTATCAAAACTAATTAAATGG + Intronic
1021083404 7:16390213-16390235 TATTAATAAGCATAATTAAATGG - Intronic
1022589641 7:31649530-31649552 TGTTAACAAGAATACTTTAGAGG - Intronic
1023379160 7:39588687-39588709 TGTTAATAAGACCAAGTAAGTGG - Intronic
1024815399 7:53263031-53263053 TGCTAACAAGTCTAATAAATTGG - Intergenic
1026419491 7:70219072-70219094 TGATCACAAGTCTAATTGAGTGG - Intronic
1027242861 7:76344359-76344381 TTTTAACAAGCCTAATTCTGAGG - Intronic
1030279497 7:107757643-107757665 TGTTAAGAACCCTAATGATGAGG + Intronic
1033154782 7:138947633-138947655 TGTTAGCAAGTGTAATTATGAGG - Intronic
1041962025 8:63629026-63629048 TGTTAATAATCCAAGTTAAGAGG + Intergenic
1043463041 8:80479647-80479669 TGTTTACAAGCCTAAAAAACAGG - Intergenic
1044808781 8:96036007-96036029 TGCTAGCAAGACTAATAAAGAGG - Intergenic
1045996871 8:108373389-108373411 TTTTAAGACCCCTAATTAAGGGG + Intronic
1048268461 8:133008686-133008708 TGTTAGCATGGCTAATTAAGTGG - Intronic
1051466869 9:17388900-17388922 TGTTATCAAGTTCAATTAAGTGG + Intronic
1052003336 9:23315608-23315630 TTTTAACAAACCAAATGAAGTGG - Intergenic
1052184640 9:25577313-25577335 TGCCAACAAGCCTAGTGAAGAGG - Intergenic
1052998816 9:34566074-34566096 TGTTAACAAGCCTAATTAAGAGG - Intronic
1055350202 9:75378719-75378741 TGTTAAAGAGGCAAATTAAGAGG + Intergenic
1057483736 9:95465737-95465759 TTTAAACAAGCCTAATTAAGTGG + Intronic
1058106899 9:100982673-100982695 TCCAAACAAACCTAATTAAGAGG + Intergenic
1058164929 9:101608395-101608417 TTTTAACAGGCCAAATTCAGGGG - Intronic
1059123770 9:111664235-111664257 GGATAATAAGCCTATTTAAGAGG + Intronic
1059717767 9:116929786-116929808 TTTTAAATAGTCTAATTAAGAGG - Intronic
1187653013 X:21431643-21431665 TATTAACCAGCCTTTTTAAGGGG + Intronic
1197536866 X:127700802-127700824 TGTTAAGAAGCCAAAGAAAGAGG - Intergenic
1199171734 X:144741346-144741368 AGTTAGCAACCCTAATAAAGAGG + Intergenic
1201413550 Y:13725179-13725201 TGCTAGCAAGACTAATAAAGAGG + Intergenic