ID: 1052998817

View in Genome Browser
Species Human (GRCh38)
Location 9:34566090-34566112
Sequence GTTAACACCACCAAGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052998815_1052998817 0 Left 1052998815 9:34566067-34566089 CCAGTGGCCTCTTAATTAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998816_1052998817 -7 Left 1052998816 9:34566074-34566096 CCTCTTAATTAGGCTTGTTAACA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998809_1052998817 26 Left 1052998809 9:34566041-34566063 CCTGTTAACGAGCCAATTAAGTT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data
1052998813_1052998817 14 Left 1052998813 9:34566053-34566075 CCAATTAAGTTGGGCCAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052998817 Original CRISPR GTTAACACCACCAAGACTGC AGG Intronic
No off target data available for this crispr