ID: 1052999732

View in Genome Browser
Species Human (GRCh38)
Location 9:34571361-34571383
Sequence GCAGTGGCCTGGCACTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 485}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052999732_1052999743 3 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999743 9:34571387-34571409 CCACATGGGAGCAGGAACCAGGG No data
1052999732_1052999741 2 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999741 9:34571386-34571408 ACCACATGGGAGCAGGAACCAGG No data
1052999732_1052999749 28 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999749 9:34571412-34571434 TGGGCAGGCAGAAGAGCAGGCGG No data
1052999732_1052999738 -5 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999738 9:34571379-34571401 ACTGCCCACCACATGGGAGCAGG No data
1052999732_1052999746 13 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999746 9:34571397-34571419 GCAGGAACCAGGGCATGGGCAGG No data
1052999732_1052999744 8 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999744 9:34571392-34571414 TGGGAGCAGGAACCAGGGCATGG No data
1052999732_1052999748 25 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999748 9:34571409-34571431 GCATGGGCAGGCAGAAGAGCAGG No data
1052999732_1052999745 9 Left 1052999732 9:34571361-34571383 CCGCCTCAGTGCCAGGCCACTGC 0: 1
1: 0
2: 1
3: 40
4: 485
Right 1052999745 9:34571393-34571415 GGGAGCAGGAACCAGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052999732 Original CRISPR GCAGTGGCCTGGCACTGAGG CGG (reversed) Intronic
900113262 1:1018499-1018521 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
900173630 1:1282330-1282352 GCAGAGCCATGGCTCTGAGGAGG - Intronic
900379548 1:2377122-2377144 GCAGTGGCCCAGCAGGGAGGAGG - Intronic
900397272 1:2458229-2458251 ACAGGGGCCGGGCACTGAGCAGG - Intronic
900599278 1:3496195-3496217 GCAGTGGCCTGGCCCCCAGCAGG - Intronic
901061134 1:6472417-6472439 GCAGGTGCCTGGCAATGAGGTGG - Intronic
901409099 1:9070526-9070548 ACAGTGGCCTGGCCTTGAGATGG - Intronic
901814403 1:11785586-11785608 GCAGTGGCCTGGCACTCGAGAGG - Intronic
902401705 1:16161409-16161431 GAAGTGGCCTGGCATAGAGCAGG - Intergenic
902551324 1:17221354-17221376 ACAGTTGACTGGCATTGAGGTGG + Intronic
902790189 1:18762506-18762528 GAAGTGGACAGGCACTGAGTAGG + Intergenic
903377274 1:22874669-22874691 GAAGGGGCCTGGCACTGGGCAGG + Intronic
903716227 1:25369276-25369298 GCATTGGCCTGGGACTCAGAAGG + Intronic
903951558 1:26998707-26998729 TCAGGGGCCTGGCATAGAGGAGG - Intronic
903956157 1:27027481-27027503 GCAGTCGCAAGGCCCTGAGGTGG - Intergenic
904494287 1:30878018-30878040 GCTGGGGTCTGGCACAGAGGAGG - Intronic
904661923 1:32091770-32091792 TCAGTGGCCTGGCAAAGAGCCGG + Exonic
904811730 1:33167574-33167596 GCAACAGCCTGGCACTGAGATGG + Intronic
905287154 1:36889018-36889040 GCATGGGCCTGGCACGCAGGAGG - Intronic
905540671 1:38757996-38758018 CCAGTGGACTGGCAGTCAGGAGG - Intergenic
905815736 1:40949383-40949405 CCAGGGGCCTGGCACAGAGCAGG + Intergenic
906115194 1:43352158-43352180 GCAGTGGATTGGCAGGGAGGAGG - Intronic
906802222 1:48748376-48748398 GCACAGGGCTGGCACTCAGGAGG - Intronic
907047570 1:51309016-51309038 GCAGGGGCCAGGCACGGAGTAGG + Intronic
907800420 1:57759628-57759650 GCAGGGGGATGCCACTGAGGTGG + Intronic
910288627 1:85579860-85579882 GCAGTGGGCTGGAACTAAAGTGG + Intergenic
910936238 1:92485932-92485954 GCAGAGCACTGGCACTGCGGGGG - Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913070849 1:115297323-115297345 GCAGTGGACTGGCTCTGGGTTGG - Intronic
913960437 1:143334669-143334691 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
914054793 1:144160242-144160264 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
914124353 1:144806119-144806141 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
914349961 1:146832224-146832246 GGAGTGGCCTGGCCATGAGCGGG - Intergenic
914438623 1:147681819-147681841 GTACTGACCTGGCACTGAGATGG - Intergenic
914952807 1:152132124-152132146 GCAGTGACCTGGCACTGGGCAGG - Intergenic
915008072 1:152658915-152658937 GCACTGGAGTGGCACTGCGGAGG + Intergenic
915010607 1:152682506-152682528 GCACTGGAGTGGCACTGTGGAGG + Intergenic
915669793 1:157478896-157478918 GGGCTGGCCTGGCACTGAGGTGG + Intergenic
916653183 1:166849610-166849632 GCAGTGTCCTGGCTCTGCGCAGG + Exonic
919091912 1:192987083-192987105 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
919201342 1:194358457-194358479 GCCGTGGGCTGGCACTGTTGGGG + Intergenic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
921521066 1:216154656-216154678 GCAGTTGCCTAGGCCTGAGGAGG - Intronic
922559306 1:226557141-226557163 GTAGTTGCCAGGCACTGAGGTGG - Intronic
922618076 1:226974746-226974768 GCCTTGGCCTGGCACTGGGCTGG + Intronic
923125145 1:231028110-231028132 GAAGTGGCCTGGCAGTGGGGTGG + Intronic
923243714 1:232110720-232110742 TCAGTGGCCTGGCATGGGGGCGG + Intergenic
1064245010 10:13661340-13661362 GCAGTGGGCAGGCAAAGAGGAGG + Intronic
1064352165 10:14586219-14586241 TCAGTGGCCTGGGATGGAGGAGG - Intronic
1064738689 10:18410092-18410114 GCAGGGCCCTGGCAAGGAGGTGG - Intronic
1065244336 10:23742272-23742294 GGAGGGGCCTGCCACTGAGCAGG + Intronic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1067080176 10:43208346-43208368 GGAGTGGCCTTGCCCTGTGGGGG - Intronic
1067338261 10:45381127-45381149 GCAGGAGCCTGGCAGGGAGGGGG + Intronic
1067448511 10:46367426-46367448 GCATTGGGCTGGCACTGCAGAGG - Intergenic
1067571889 10:47377906-47377928 GAAGTGGCCTGGCACTCCTGAGG - Intronic
1067588863 10:47493339-47493361 GCATTGGGCTGGCACTGCAGAGG + Intergenic
1067635989 10:48001430-48001452 GCATTGGGCTGGCACTGCAGAGG + Intergenic
1067696934 10:48542545-48542567 GCAGAGGCCTGGGAATCAGGAGG - Intronic
1068122855 10:52801612-52801634 ACAGTGGCCTGGGGGTGAGGTGG + Intergenic
1068857391 10:61811504-61811526 GCAGTTGCCTAGGACTAAGGGGG + Intergenic
1068978148 10:63033761-63033783 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1069557533 10:69407779-69407801 GCAGGGGCCAGGCTCTGAGGAGG - Intronic
1069942782 10:71966281-71966303 GCAGTGGCTTGGCTCTGTGGTGG + Intronic
1070016037 10:72532452-72532474 GCATGGGCCTGGCACACAGGAGG - Intronic
1070132553 10:73665438-73665460 GCATTGGGCTGGCACTGCAGAGG + Intergenic
1070171797 10:73938542-73938564 GGAGTGGCCTGGCCAAGAGGAGG - Intergenic
1071041083 10:81309263-81309285 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1071609130 10:87018637-87018659 GCATTGGGCTGGCACTGCAGAGG - Intergenic
1072674006 10:97452172-97452194 GCAGAGTCGTGGCACTGAGTAGG - Exonic
1072878761 10:99203495-99203517 GGATTGGCCTGGCACTGGGCGGG - Intronic
1073532525 10:104245345-104245367 CCAGTGGGCTGGCACTGCTGGGG - Intronic
1074807563 10:117068505-117068527 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1074807636 10:117069381-117069403 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1075567502 10:123515277-123515299 GCAGTGGCCTGGAGGTCAGGAGG + Intergenic
1075795318 10:125116047-125116069 GCACAGTCCTGGCACTGAGTAGG - Intronic
1076405751 10:130211696-130211718 GCGGTGGCATGAGACTGAGGTGG + Intergenic
1076589181 10:131571485-131571507 GCCGTGGCCTGGGATTCAGGCGG - Intergenic
1076619081 10:131775566-131775588 GCCGCGTCCTGGCCCTGAGGCGG - Intergenic
1076754717 10:132563209-132563231 GCAGGGACCTGGCACTCAGCAGG - Intronic
1077179421 11:1205655-1205677 GCAGTGCCCTGCCACCCAGGAGG + Intergenic
1077800427 11:5530711-5530733 GCACTGGCCTGGCTCTGGGCTGG + Intronic
1078479575 11:11664208-11664230 GCTGTGGGTTGGCACAGAGGGGG - Intergenic
1078549851 11:12272485-12272507 GCACAGGCCTGGATCTGAGGAGG + Intergenic
1079431029 11:20388161-20388183 GCAGAGGCCAGGCGCTGAGGCGG - Intronic
1079731747 11:23942466-23942488 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1080172002 11:29315739-29315761 GCACTGTGCTGGCACTGAGTAGG - Intergenic
1080855109 11:36105355-36105377 CCAGGGGCCTGGCACAGGGGAGG - Intronic
1081428396 11:42950058-42950080 CCAGTGGTCTGGCACTGCTGGGG - Intergenic
1081473824 11:43404490-43404512 GCATTAGCCTGGCACACAGGTGG - Intronic
1081741900 11:45446819-45446841 GCATTGGCCTGGAAGTCAGGAGG + Intergenic
1081794824 11:45811923-45811945 GCAGTGGCCTGGGAATGGGGTGG + Exonic
1083546119 11:63550378-63550400 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1085245607 11:75098379-75098401 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1085478900 11:76805759-76805781 GTACTGGGCTGGCACAGAGGAGG - Intergenic
1086887518 11:92222998-92223020 GCAGGAGCCAGGCACTCAGGTGG + Intergenic
1087277773 11:96177482-96177504 GCAGTGGCCTGTCACTTGGACGG - Intronic
1087354550 11:97076773-97076795 CCAGTGGGCTGGCACTGCTGAGG - Intergenic
1089315815 11:117590583-117590605 GCAGGGACCTGGCTCTGAGCAGG - Intronic
1089748567 11:120634303-120634325 GCATAGCCCTGGCACTGAGTAGG - Intronic
1089752384 11:120660882-120660904 GCTGTGGCCTGGCTCTGAGAGGG + Intronic
1090878204 11:130810173-130810195 GCAGGGGCCTGGGATTGAGGGGG + Intergenic
1091278133 11:134366106-134366128 GCAGTGGCCTGGCCCATGGGTGG + Intronic
1091369397 11:135046131-135046153 GCAGGGCCATGGCACAGAGGAGG + Intergenic
1091753574 12:3037724-3037746 GCAGTGGCCTGAAACTGTGTGGG + Intronic
1091768113 12:3135040-3135062 GCAGTGCCTAGGCACTGAGAAGG - Intronic
1091832240 12:3557990-3558012 GGGGTGGGCTGGCACTGAGAGGG - Intronic
1092500027 12:9036241-9036263 GCTGTGGCCTGACTGTGAGGCGG + Intergenic
1093342764 12:17998566-17998588 GAGCTGACCTGGCACTGAGGTGG - Intergenic
1093581015 12:20783968-20783990 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1094512699 12:31105817-31105839 GCAGTGGCCGGGGCCTGGGGTGG + Intergenic
1095312994 12:40723124-40723146 GCGGGAGCCTGGCACAGAGGAGG + Intronic
1096388009 12:51207847-51207869 ACAGTGGCCTGTAACAGAGGAGG + Intronic
1096464117 12:51838754-51838776 GCAGTGGCCTGGGAAAGAGGTGG + Intergenic
1096847143 12:54413544-54413566 GGTGGGGCCTGGCACGGAGGTGG - Intronic
1097042521 12:56164306-56164328 GCAGTGGGCTGGCACTGGGCAGG + Exonic
1097972575 12:65650255-65650277 GAAGTGGCCTGCCACTCAAGAGG - Intergenic
1100144151 12:91656727-91656749 TCAGTAGCCTGGGAATGAGGAGG - Intergenic
1100211875 12:92406706-92406728 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1100712840 12:97276030-97276052 GCAGAGGCAGGGCACTGTGGTGG + Intergenic
1101428088 12:104604228-104604250 GCAGTAGCCTGGGACTTGGGAGG + Intronic
1101880821 12:108624298-108624320 GCAGAGGCATGGCACCTAGGAGG + Exonic
1101954496 12:109201368-109201390 GCACTTGCCTGGCACTTAGCAGG + Intronic
1102413915 12:112743974-112743996 GCACTGGCCTGGCACATAGTAGG + Intronic
1103014436 12:117482766-117482788 ACAGTGGCTTGTCCCTGAGGTGG - Intronic
1104042710 12:125140804-125140826 GCAGATGGCTGGCTCTGAGGAGG + Intronic
1104964542 12:132503021-132503043 GCTGTGGCCTGGCCCTGTGCGGG - Intronic
1105876676 13:24560893-24560915 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1105891496 13:24685565-24685587 ACACTGGCCTGGCAGTGAGAGGG + Intronic
1106559206 13:30834001-30834023 GCGGGGGCCTGGTGCTGAGGGGG + Intergenic
1106807993 13:33331291-33331313 GGAGTGGCTTGTCACAGAGGAGG - Intronic
1107726540 13:43305136-43305158 CCAGTGGCCAGGCACAGAGCTGG + Intronic
1107957554 13:45531320-45531342 GGAGTAGCCTGGCGCTGTGGAGG + Intronic
1108751525 13:53452581-53452603 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1108858951 13:54829688-54829710 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1112554281 13:100452345-100452367 GGAGTAGCATGGCAGTGAGGTGG - Intronic
1113047394 13:106170588-106170610 GCATTGGCCTGGCACATAGCAGG - Intergenic
1114152149 14:20054491-20054513 GCAGAAGATTGGCACTGAGGGGG - Intergenic
1117021538 14:51575937-51575959 CCAGTGGCCTGGTGCTGATGGGG - Intronic
1119050303 14:71361261-71361283 GCACTGGGCTGGCAGTCAGGAGG + Intronic
1119649561 14:76374080-76374102 GCAGCGGCCTGTCACTCAGCAGG + Intronic
1119666529 14:76488982-76489004 GCACAGGCCTGGCACTTAGTAGG + Intronic
1119875068 14:78052366-78052388 GCAGAGGCCTACCACTGAGTAGG + Intergenic
1119887706 14:78157273-78157295 GCAGTGGACTTGCATTTAGGAGG + Intergenic
1121310481 14:92932870-92932892 TCCGTGGCCTGGCACAGAGCTGG - Intronic
1122083258 14:99281730-99281752 GCACAGGCCTGGCACAGAGGAGG + Intergenic
1122089382 14:99328207-99328229 GCAGTGGCCTGGCACACAGTAGG - Intergenic
1122203470 14:100136551-100136573 GCACAGGCCTGGCACAGAGCAGG - Intronic
1122927882 14:104917002-104917024 GCAGCGGCCTGGAATTGAGTCGG - Intergenic
1125506749 15:40271753-40271775 GAAGAGGCCTGGCAGTGGGGTGG - Intronic
1126257221 15:46642250-46642272 CCAGTGGCATGGCACTCAAGTGG + Intergenic
1126688364 15:51267537-51267559 GCAGTGGCCGGCCACGGACGTGG - Intronic
1128381637 15:67117473-67117495 GCAGTGGGGTGGCACTGGGCTGG - Intronic
1128417624 15:67461253-67461275 ACATGGGCCTGGCACGGAGGAGG + Intronic
1128621759 15:69157211-69157233 GCAGTGAGCTGCCACGGAGGGGG - Intergenic
1129856303 15:78827755-78827777 GCAGAGGCCTGGGAGTGATGGGG + Intronic
1130015890 15:80186115-80186137 GCAGTACCCTGGAACAGAGGAGG - Exonic
1130017806 15:80201277-80201299 GCAGTGGTGTGGCAGTGAGGGGG - Intergenic
1130303700 15:82699248-82699270 CCAGTGGACTGGAACTTAGGTGG - Intronic
1130904080 15:88227770-88227792 TCAGTGGCCCAGAACTGAGGTGG - Intronic
1132024070 15:98390138-98390160 GTAGTTGCCAGGGACTGAGGGGG + Intergenic
1132166897 15:99602321-99602343 ACAGTGGCCTAGCACTTGGGAGG + Intronic
1132386151 15:101401429-101401451 CCAGTGTCCAGGCACTGAGATGG + Intronic
1132660343 16:1058229-1058251 GCAGAGGCCGGACACTGAGCAGG - Intergenic
1133020824 16:2966316-2966338 CAGGTAGCCTGGCACTGAGGGGG - Exonic
1134139258 16:11703009-11703031 GAGGAGGCCTGGCACTGAGTAGG + Intronic
1135138964 16:19905735-19905757 TCAGAGGCATGGCAGTGAGGAGG - Intergenic
1135819655 16:25671973-25671995 GCTGTGGCCTGGAACTGAACTGG + Intergenic
1136042021 16:27587001-27587023 GAGATGGCTTGGCACTGAGGTGG + Intronic
1138590796 16:57998746-57998768 CCAGGGGCGGGGCACTGAGGTGG - Intronic
1138679155 16:58672484-58672506 TCAGTGCCAAGGCACTGAGGTGG - Intronic
1139125530 16:64072516-64072538 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1139592235 16:67939748-67939770 GCTGAGGCCTGGGACTGAGCTGG - Exonic
1139984077 16:70883307-70883329 GGAGTGGCCTGGCCATGAGCGGG + Intronic
1140137363 16:72219283-72219305 ACAGTGCCCTGGCACTGTGAAGG + Intergenic
1140993125 16:80233604-80233626 CCAGTGACCTGCCACTGGGGAGG - Intergenic
1141172395 16:81699761-81699783 GCATGCTCCTGGCACTGAGGGGG + Exonic
1141360462 16:83390926-83390948 GCAGAGGCCTGGCTCTTAGCAGG + Intronic
1141426525 16:83947807-83947829 GAAGGGGCCTGGCACTGGGGAGG - Intronic
1141648448 16:85379675-85379697 TCAGTGGCCTGGCAGGGAGCAGG - Intergenic
1141881778 16:86865049-86865071 GCACTGTTCTGGCCCTGAGGAGG + Intergenic
1141892133 16:86933414-86933436 GCAGTCACCCAGCACTGAGGAGG + Intergenic
1143255352 17:5553646-5553668 GCTGTGGCCTGGTGCTCAGGGGG - Intronic
1143376693 17:6471408-6471430 GCATGGGGCTGGCACTGAGTGGG - Intronic
1144457605 17:15431985-15432007 GCAACGGCCTGGCACAGAGTCGG - Intergenic
1144788461 17:17844629-17844651 GCAGTCTCCAGGCACTGAGCAGG - Intronic
1145016461 17:19401799-19401821 GCAAAGGCCTGGCAGTGAGTTGG - Intergenic
1145057104 17:19709994-19710016 GCACTGGCCTGGCAGAGAGGTGG + Intronic
1146054189 17:29573031-29573053 GCACTGGCCGAGCACTGCGGGGG + Exonic
1146480500 17:33201347-33201369 CCAGTAGCCTGGGACTGAGGGGG + Intronic
1146788673 17:35739240-35739262 GCAGGGGCCAGGCACAAAGGAGG - Intronic
1146842549 17:36166037-36166059 GCAGAGGCAAGGCCCTGAGGTGG + Exonic
1146854861 17:36253996-36254018 GCAGAGGCAAGGCCCTGAGGTGG + Exonic
1146865759 17:36334380-36334402 GCAGAGGCAAGGCCCTGAGGTGG - Exonic
1146870761 17:36377888-36377910 GCAGAGGCAAGGCCCTGAGGTGG + Exonic
1146878119 17:36428969-36428991 GCAGAGGCAAGGCCCTGAGGTGG + Exonic
1146882060 17:36450073-36450095 GCAGAGGCAAGGCCCTGAGGTGG + Intergenic
1147068629 17:37934992-37935014 GCAGAGGCAAGGCCCTGAGGTGG - Exonic
1147073644 17:37978512-37978534 GCAGAGGCAAGGCCCTGAGGTGG + Intronic
1147080151 17:38014529-38014551 GCAGAGGCAAGGCCCTGAGGTGG - Intronic
1147085166 17:38058050-38058072 GCAGAGGCAAGGCCCTGAGGTGG + Exonic
1147096100 17:38138489-38138511 GCAGAGGCAAGGCCCTGAGGTGG - Intergenic
1147101112 17:38182016-38182038 GCAGAGGCAAGGCCCTGAGGTGG + Intergenic
1147148253 17:38498517-38498539 GCAGGGGCCTGGGAGTGGGGAGG + Intronic
1148358914 17:46995931-46995953 GCAGGGACCAGCCACTGAGGTGG - Intronic
1148784724 17:50140493-50140515 GCAGGGGACATGCACTGAGGAGG + Intronic
1148924335 17:51069985-51070007 GCAGTGGCATGCACCTGAGGTGG + Intronic
1148972794 17:51499005-51499027 GCATTGGCTTAGCACTCAGGTGG - Intergenic
1150327733 17:64270063-64270085 GCACTGGCTTGGCACTGAATGGG + Intergenic
1150788807 17:68183898-68183920 GCTGAGGCCTGGCACTCAGCGGG + Intergenic
1151247548 17:72806505-72806527 ATAGTGGGCTGGCACTTAGGGGG + Intronic
1151455549 17:74223578-74223600 GGAGTGGCCAGGCAGTGTGGTGG - Intronic
1151893416 17:76964364-76964386 GAGGTGGCCTGGCACTGGGTAGG + Intergenic
1152143272 17:78551282-78551304 GCACTGGCCTGGCACAGAGGGGG + Intronic
1152299586 17:79487236-79487258 GCACTGGCCAGGCAGAGAGGAGG + Intronic
1152656816 17:81523685-81523707 GTCAGGGCCTGGCACTGAGGTGG + Intronic
1153622387 18:6990997-6991019 GCACTCTCCTGGCACAGAGGAGG + Intronic
1154323079 18:13369944-13369966 GCCGTGGCTTGGAACTGTGGGGG + Intronic
1154356129 18:13624404-13624426 GCAGGAGCCAGGCACTGAGTAGG + Intronic
1155217577 18:23657017-23657039 GCAGTGGCCTGGAAGCCAGGTGG - Intronic
1156789458 18:40953825-40953847 GCAGAAGCCTGCCACAGAGGAGG + Intergenic
1156988181 18:43374404-43374426 GCTGTGGCCTGGTGCTGATGAGG - Intergenic
1157849045 18:51030468-51030490 GCAGCGGCGCGGCGCTGAGGAGG + Exonic
1160176613 18:76600317-76600339 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1160761833 19:789363-789385 GAAGTCGCCTGTCACTGCGGTGG + Intergenic
1161066303 19:2240070-2240092 CCAGTGGCCTGGCAAGGAGCGGG + Intronic
1161400075 19:4063354-4063376 GCAGTGGGCTGGCTCTGGGGAGG + Intronic
1161562910 19:4983635-4983657 GGAGGCGCTTGGCACTGAGGAGG + Intronic
1161950140 19:7463338-7463360 GCTGTGGCCAGGCACAGAGGTGG - Intronic
1162412859 19:10517156-10517178 GCAGTGGCCCGGCCAGGAGGGGG + Intronic
1162790732 19:13061395-13061417 CCAGTGGCCTGGGCCTGAGTGGG + Intronic
1163144298 19:15370238-15370260 GCAGTGGCCAGGGACTGGGCTGG - Intronic
1163254051 19:16144156-16144178 GTGCTGGCCTGGCACAGAGGAGG - Intronic
1163764442 19:19154899-19154921 GCACAGGCCTAGCACAGAGGGGG - Intronic
1164270578 19:23668714-23668736 CCAGTGGGCTGGCACTGCTGGGG + Intronic
1164609743 19:29623985-29624007 GCAGGGGCATGGCGCTGAGGAGG + Intergenic
1165070706 19:33253504-33253526 GCAGGGGCCAGGAACGGAGGGGG - Intergenic
1165132096 19:33639372-33639394 GCAGGGGCATGGCACTGGGATGG + Intronic
1165365074 19:35360238-35360260 GCAGTGCCCAGGGTCTGAGGGGG + Exonic
1166117676 19:40665753-40665775 GCTGAGGCCGGGCACTGAGGTGG - Intergenic
1166343519 19:42151903-42151925 GCACTGGCCTGGCACAGCTGTGG + Intronic
1166568481 19:43779359-43779381 GCAGGCGGCGGGCACTGAGGGGG - Intronic
1166863127 19:45821105-45821127 GCTGTGCCCTGGCACAGAGTGGG - Intronic
1166938760 19:46350497-46350519 AGAGGGGCCTGGCACTGAGCTGG + Intronic
1166965646 19:46528206-46528228 AGAGGGGCCTGGCACTGAGCTGG - Intronic
1167262953 19:48469372-48469394 GCTGAGGACTGGCGCTGAGGAGG + Exonic
1202694273 1_KI270712v1_random:112920-112942 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
926616627 2:15002722-15002744 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
927866475 2:26591161-26591183 CCAGAGGCCTGCCACTGGGGTGG - Intronic
928036439 2:27828559-27828581 GCAATGCCCTGGCATTCAGGAGG + Intronic
928189108 2:29145276-29145298 GCAGTGGGCTGGCATTGAACTGG + Exonic
929617265 2:43321776-43321798 GCCATGGCCAGGCACTGAGGTGG - Intronic
929786693 2:44998716-44998738 GAAGAGCCCTGGCACTGATGGGG - Intergenic
930309128 2:49715750-49715772 GCAATAGCCTGGCAGTGTGGAGG + Intergenic
932359514 2:71092675-71092697 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
932766756 2:74475297-74475319 GCAGGGGCCTGGGCTTGAGGTGG + Exonic
933952286 2:87341648-87341670 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
934236527 2:90237987-90238009 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
934639037 2:96015311-96015333 GCACTGACCTGGCTCTGTGGTGG - Intergenic
934735549 2:96688068-96688090 GCAGTAGCCCTGCACTGAAGAGG + Intergenic
934794611 2:97090101-97090123 GCACTGACCTGGCTCTGTGGTGG + Exonic
934886438 2:98029492-98029514 GCAGGGGCTTGGCCCTGGGGAGG - Intergenic
935626512 2:105176249-105176271 GCACTGGCCAGGCACAGAGTGGG - Intergenic
936713443 2:115160516-115160538 GCAGTGGGGTGGCAGTGAGTTGG - Intronic
938173483 2:129103442-129103464 GCATGGGCCTGGTACTTAGGAGG + Intergenic
938236088 2:129708374-129708396 GCAGGGGCCAGGCATTGTGGAGG + Intergenic
938778153 2:134560028-134560050 GCCGTGGCCTGGCTGTGGGGAGG - Intronic
941721406 2:168816803-168816825 GCATGGGCTTGGCACTGAGTAGG + Intronic
941868439 2:170358404-170358426 GTGGTTGCCTGGGACTGAGGAGG + Intronic
943084975 2:183300535-183300557 GCAGTGGCCTTGCTCTGCTGCGG + Intergenic
943954924 2:194176486-194176508 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
944642376 2:201740939-201740961 GCAAATGCCTGGCACTGAGTGGG + Intronic
945285661 2:208078852-208078874 GCTCTGGGCTGGTACTGAGGAGG - Intergenic
945374179 2:209059865-209059887 GCAGTGGCCTGGCTCTCACATGG + Intergenic
946178931 2:217938362-217938384 GCAGAGGCCTGGGACAGAGAGGG + Intronic
947103803 2:226648180-226648202 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
947343223 2:229161765-229161787 GCAGTGGCATCCCACTTAGGTGG + Intronic
947529181 2:230898071-230898093 GCAGCCTCCTGGCACAGAGGTGG + Intergenic
947542677 2:230989819-230989841 ACAGAAGCCTGGAACTGAGGGGG + Intergenic
948542407 2:238700004-238700026 GAAGTGGCTTGGCCCTGAGCAGG + Intergenic
948667565 2:239545996-239546018 GCAGGGGCATGGCGCTGGGGAGG - Intergenic
948695745 2:239732281-239732303 TCACTGGCCTGGCAGGGAGGAGG - Intergenic
948840824 2:240648063-240648085 GCAGTGGCTTGGGGCAGAGGTGG + Intergenic
948844618 2:240677108-240677130 GCTGTGGCCTGGCGTAGAGGTGG + Intronic
948846956 2:240687777-240687799 GGAGTGGCCTGGCCCTGCCGTGG + Intergenic
948849242 2:240697771-240697793 GCTGTGGCCTGGCGTAGAGGTGG - Intronic
948910306 2:240999254-240999276 GCAGCCGCCGGGCACCGAGGCGG + Intronic
1169754470 20:9028816-9028838 GCACTGGACTTGCACTGAGAAGG - Intergenic
1170177377 20:13487320-13487342 GCAGGGGCCTGACACTGTTGGGG - Intronic
1170318642 20:15069796-15069818 GCAGTAGCCTGCTACAGAGGCGG + Intronic
1170694690 20:18647731-18647753 GCAGTGGGCAGCCACTGAGGAGG + Intronic
1171454498 20:25259974-25259996 GCGGTGGCAGGGCGCTGAGGTGG - Intronic
1172028798 20:31967770-31967792 CCAGTGGCCTGGGTCTGACGGGG - Intergenic
1172289469 20:33765768-33765790 CCAGTGGCCTGGCACATAGTAGG - Intronic
1172689506 20:36780555-36780577 TCAGTGCCCTGGCCCTGGGGTGG - Exonic
1173178977 20:40787438-40787460 CCGCTGGCCTGGCCCTGAGGGGG - Intergenic
1173223223 20:41146187-41146209 GCCCAGGCCTGGCACAGAGGAGG + Intronic
1173562682 20:44017433-44017455 GCTCTCGCCTGGCACAGAGGTGG - Intronic
1173910457 20:46665408-46665430 GTAGTTGCCTGGGACTGGGGAGG - Intronic
1173962744 20:47087831-47087853 GCACAGGCCTGGCAGTTAGGAGG - Intronic
1174362422 20:50037347-50037369 GCAGGAGCCTGGCACTCAGCAGG - Intergenic
1174434193 20:50493768-50493790 GCAAGTGCCTGGCACAGAGGCGG - Intergenic
1174912012 20:54617718-54617740 GCAGGGGACAGACACTGAGGTGG - Intronic
1175036613 20:56005793-56005815 GCAGTGGAGTGGCACGGGGGCGG - Intergenic
1175897697 20:62346638-62346660 GGAATGGGCTGGCCCTGAGGTGG - Intronic
1175991360 20:62791374-62791396 GCCGTGGCCTGGCCCTGCAGGGG + Intergenic
1176096420 20:63346491-63346513 GCAGTGGCTTGGAGCAGAGGTGG - Exonic
1176124239 20:63468420-63468442 GCAGGCGCCTGGCACAGTGGTGG - Intronic
1176130588 20:63495168-63495190 GGAGAGGCCTGGAAGTGAGGTGG - Intronic
1177410050 21:20718214-20718236 TCAGTGGCCTTGCTTTGAGGTGG + Intergenic
1177496940 21:21902597-21902619 TCAGTGGGCTGGCACTGCTGGGG - Intergenic
1178609260 21:34066824-34066846 GCAGTGTCATGACACTTAGGTGG + Intergenic
1179479361 21:41667986-41668008 GCATTGGCATGGAAGTGAGGAGG + Intergenic
1179542381 21:42091918-42091940 GCACTGACCTGGCACTGTTGGGG - Intronic
1179880861 21:44292866-44292888 GCAGAGGCCTGGCATGGTGGGGG - Intronic
1180006955 21:45027276-45027298 GCAGGGACCAGGCAGTGAGGAGG + Intergenic
1180120131 21:45740304-45740326 GAAGTGACCTGCCAGTGAGGCGG - Intronic
1180199410 21:46215563-46215585 CCTGGGGCCTGGCACAGAGGAGG + Intronic
1180592779 22:16955313-16955335 GCAGTGGACTGGGACAGAGGTGG + Intergenic
1181173634 22:21023822-21023844 GCAGGGGCCTGGGACAGATGGGG - Intronic
1181727224 22:24820039-24820061 GCAGTGGGCAGGCACCCAGGAGG + Intronic
1182474793 22:30571184-30571206 ACAGGGGCCTGGGACTGAGAAGG + Intronic
1182600689 22:31461288-31461310 GCAGTGACCTGGCTCTAAGGTGG - Intronic
1182746948 22:32613374-32613396 GCAATGGCCTTGCAAGGAGGAGG - Intronic
1182829848 22:33296189-33296211 ACGGGGGCCTGGCACTAAGGAGG + Intronic
1183319600 22:37156993-37157015 GGTGAGGCCTGGCACTGTGGGGG - Intronic
1183596143 22:38813222-38813244 CCAGTGCCCTGGCACAGAGTAGG - Intergenic
1183683540 22:39349349-39349371 GGAGGGGCCTGGCACAGAGGCGG - Intergenic
1184147335 22:42619312-42619334 GCCTGGGCCTGGCCCTGAGGCGG + Exonic
1185046917 22:48533157-48533179 GGAGTGGCCGGGGTCTGAGGAGG + Intronic
950419696 3:12891588-12891610 CCTGTGGCCTGGGACTGAGAGGG - Intergenic
950427254 3:12931184-12931206 GCCCTGGCCTGGGTCTGAGGTGG - Intronic
950475985 3:13215129-13215151 GCAGGAGCCTGGCACAGGGGAGG - Intergenic
952203204 3:31152063-31152085 ACAGTGGACTGGCATTGTGGGGG - Intergenic
952593646 3:34988549-34988571 CCGGTGGCCTGGCACTGCTGGGG - Intergenic
954419380 3:50410556-50410578 GCAGTGGGCTGGGAATCAGGTGG - Intronic
954620138 3:51990745-51990767 CCGGTGGCCTGGCACTGCTGGGG - Intergenic
954668635 3:52275428-52275450 GGAGTGGCCTGGTAGTTAGGAGG - Intronic
954876122 3:53804213-53804235 GAAGTGGAATGGCAGTGAGGTGG + Intronic
956230169 3:67005786-67005808 GCAGATGCCTGAGACTGAGGTGG - Intronic
959759492 3:109942933-109942955 GCATTGGCATTGCACTGATGAGG - Intergenic
960634146 3:119767443-119767465 CCAGTGGCCTAGAACTGAGTAGG - Intergenic
960961343 3:123072579-123072601 GCAGCAGCCTGGCAGAGAGGAGG - Intronic
961333449 3:126156402-126156424 GCAGTGGCCAGGAGCTGAGGAGG + Intronic
961440907 3:126952654-126952676 GCTGTGGCCTGGGACGGAGATGG + Intronic
961450032 3:126998501-126998523 GCAGTGGTATGTGACTGAGGTGG + Intronic
961601873 3:128068504-128068526 GCAGTGGCTGGGCACGGAAGGGG + Intronic
963397218 3:144749985-144750007 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
964452136 3:156822864-156822886 CCAGTGGGCTGGCACTGCGGGGG + Intergenic
965200337 3:165649504-165649526 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
966096782 3:176213607-176213629 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
967298227 3:187986479-187986501 GCATTGGCGTGGCACACAGGAGG + Intergenic
967754012 3:193148058-193148080 TCATTTGCCTGGGACTGAGGGGG - Intergenic
968068929 3:195774021-195774043 GCAGAGGCCTGACATTAAGGAGG + Intronic
968448681 4:665059-665081 GCCCTGGCCTGGCCCCGAGGTGG - Intronic
968581183 4:1396119-1396141 TCAGTGACTTGGCACTAAGGGGG + Intergenic
968624844 4:1622473-1622495 GCAGTGCCCTGGGAGGGAGGAGG - Intronic
968755430 4:2413517-2413539 GCGGGCGCCTGGCACGGAGGGGG - Intronic
969300212 4:6293082-6293104 ACAGTGTCCTGCCACCGAGGTGG + Intronic
969306749 4:6330187-6330209 GCAGAGGGCTGGCACTCATGCGG - Intronic
969602194 4:8183010-8183032 GCAGGGGCCTGACCCAGAGGAGG + Intronic
969839913 4:9873625-9873647 TCATTGGTCTGGCACTGAGAAGG - Intronic
969951047 4:10835904-10835926 GCAGTGGGCTGTCATAGAGGTGG + Intergenic
971092517 4:23361534-23361556 GCAGTAGCCTTGCACAGAGCTGG + Intergenic
971923614 4:32976814-32976836 GCAGTTGCCTGACATTGAGCAGG + Intergenic
972298641 4:37764480-37764502 GCAGTTGCATGACACAGAGGTGG - Intergenic
973048581 4:45567226-45567248 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
973587757 4:52409933-52409955 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
973765085 4:54155311-54155333 CCAGTGGGCTGGCACTGCTGTGG + Intronic
973982870 4:56320902-56320924 GCACTGGCCTCCCCCTGAGGTGG + Intronic
974892287 4:67896749-67896771 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
975596358 4:76050844-76050866 CCAGTGGGCTGGCACTGCTGGGG + Intronic
976117833 4:81746858-81746880 ACAGTGCCCTGGCACTCACGGGG + Intronic
977416670 4:96742692-96742714 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
980043371 4:127964424-127964446 CCAGTGGGCTGGCACTGCTGGGG + Intronic
982449310 4:155533158-155533180 GAAGTGCCCTGGCTCAGAGGAGG - Intergenic
982863388 4:160481933-160481955 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
982868797 4:160550295-160550317 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
984510534 4:180673431-180673453 TCAGTGGACTTGAACTGAGGGGG - Intergenic
985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG + Intronic
985997749 5:3606206-3606228 CACGTGGCCTGGGACTGAGGAGG + Intergenic
986435591 5:7727155-7727177 GCCGTGGCCCGGTACTGAGGGGG - Exonic
986583167 5:9286558-9286580 GTAGTTTCCTGGCAGTGAGGTGG - Intronic
987990241 5:25200210-25200232 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
989455365 5:41637581-41637603 GCAGTGGCCTGAGGCTGAGTGGG - Intergenic
989956856 5:50369612-50369634 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
991422361 5:66454363-66454385 GCAGTGTCTTGGCACTGGAGTGG - Intergenic
993052405 5:82940718-82940740 ACAGTGGGCTGGCACAGAGGTGG - Intergenic
993643456 5:90434285-90434307 GCAGTGCCTTGGCTGTGAGGTGG - Intergenic
994094635 5:95838101-95838123 GCAGTGACATGGCAGTGGGGAGG + Intergenic
996271435 5:121609297-121609319 GAAGTTGCCTGGGACTGAGTTGG + Intergenic
997199166 5:131999421-131999443 GCAGGCTCCTGGCACTGAGGAGG + Intronic
997868968 5:137490089-137490111 GCAGAGGCCTGGCACATAGCTGG + Intronic
998081453 5:139278441-139278463 CCACAGGCCTGGCACAGAGGAGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999274622 5:150321232-150321254 ACAGTGGCCTGGCATACAGGAGG + Intronic
999793599 5:154966692-154966714 GCACTGGCCTCGTCCTGAGGTGG - Exonic
1000547619 5:162622017-162622039 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1000782516 5:165500140-165500162 GCAGTGGTCTGATACTGAGCTGG - Intergenic
1001600680 5:172926334-172926356 GCAGGGGCCTGGCACATAGTAGG - Intronic
1001677338 5:173529550-173529572 GCAGAGGCCAGGAACAGAGGAGG - Intergenic
1001743267 5:174070879-174070901 GCACTGGCCTGGCATGGAGCAGG + Intronic
1001794971 5:174494291-174494313 GCAGTGGGCTGACACTGATATGG + Intergenic
1001810557 5:174624513-174624535 GCAGTGTCCAGACACAGAGGTGG + Intergenic
1002096359 5:176833558-176833580 GCCATGGCCTGGGACTCAGGTGG + Intronic
1002196162 5:177502760-177502782 GCTGTGTGCAGGCACTGAGGAGG + Intronic
1002907017 6:1457157-1457179 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1003646275 6:7915214-7915236 GCAATCGCCAGGCACTGAGGAGG - Intronic
1004338885 6:14789549-14789571 GCACTGGCCTGGGAGTTAGGAGG + Intergenic
1004400029 6:15279847-15279869 TCAGTCTCCTGGCACTTAGGAGG + Intronic
1004912641 6:20301426-20301448 CCAGTGGTCTGGCACTGCTGGGG - Intergenic
1006687922 6:35853156-35853178 GAAGGGGCAGGGCACTGAGGTGG + Intronic
1006931997 6:37694184-37694206 GTATTGCCCTGGCACTGGGGAGG - Intronic
1007032249 6:38639447-38639469 GACGTTGCCTGGGACTGAGGAGG - Intronic
1007636479 6:43302670-43302692 GCACTGTCCTGGCAGTGATGGGG + Exonic
1007968132 6:46022682-46022704 GCAGAGGCCTGGGAGTGAGCTGG + Intronic
1008036316 6:46749140-46749162 GCAGTGGCCAGGCACAGCTGTGG - Intronic
1008127089 6:47680963-47680985 CCAGTGGCCTGGCTCGCAGGAGG + Intronic
1008581238 6:52909350-52909372 CATGTGGCCTGGCACTGATGTGG + Intronic
1013757182 6:113475784-113475806 GGACTTGCCTGGCACTGAGATGG + Intergenic
1013894175 6:115065567-115065589 GCAGTGAACTGGGATTGAGGTGG - Intergenic
1014788479 6:125644626-125644648 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1014921064 6:127214776-127214798 CCGGTGGCCTGGCACTGCTGGGG + Intergenic
1016264636 6:142217374-142217396 GCAGGTGCCTGGCACTGTGCTGG + Intronic
1017343159 6:153349653-153349675 TCAGAGACCTAGCACTGAGGTGG + Intergenic
1017515382 6:155151706-155151728 GCAGTGGAGTGGCACTGTGCTGG + Intronic
1017719057 6:157232400-157232422 GCAGAAGCAGGGCACTGAGGGGG + Intergenic
1018299538 6:162386589-162386611 GCACTGGGCTGGCCCTCAGGAGG + Intronic
1018377932 6:163231284-163231306 TCAGTGGCATGGCAGTGAGTGGG - Intronic
1018478910 6:164170627-164170649 GCACAGGCCAGGCAATGAGGAGG - Intergenic
1018727725 6:166626874-166626896 GCAGGTGCCGGGCACTGAGCGGG - Intronic
1018968481 6:168507941-168507963 GCAGTGGCCTTGCCCAGATGTGG - Intronic
1019321342 7:416866-416888 GCAGTGACCTGCCACTGCGCTGG - Intergenic
1019463698 7:1174976-1174998 TCAGGGGCCTGGAAGTGAGGTGG - Intergenic
1022750443 7:33219148-33219170 CCAGTGGTCTGGCACTGCTGGGG - Intronic
1023728096 7:43164590-43164612 GCAGGGGCCTGACCCTCAGGAGG - Intronic
1023999443 7:45181048-45181070 GCAAGTGCCTGGCACAGAGGAGG - Intronic
1024238481 7:47415549-47415571 GCAGAGGCCTGGCACACCGGTGG + Intronic
1024494988 7:50035348-50035370 GCAGTGGCCTTGAACTGTGCTGG - Intronic
1024700736 7:51901622-51901644 GCAATGCCCCGGCACTGATGTGG - Intergenic
1028070105 7:86440741-86440763 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1028160271 7:87476423-87476445 GCACTGGACTGGGACTCAGGAGG - Intronic
1028349916 7:89833658-89833680 GCAGTGGCCGGGCACGGTTGAGG + Intergenic
1029422593 7:100478882-100478904 GCAGTGGCGGGGCACGCAGGCGG + Exonic
1030505800 7:110420551-110420573 GACGTGGCCTGGCACTGTGAGGG + Intergenic
1032773848 7:135090034-135090056 GCACTGGCCTGACTCTGGGGAGG + Intronic
1034164219 7:149013274-149013296 GCTGGGGCCTGGCACACAGGAGG + Intronic
1034276711 7:149827004-149827026 GCCCGGGACTGGCACTGAGGAGG + Intergenic
1034564238 7:151900569-151900591 ACAGTTGCCTGGCACTTAGTAGG + Intergenic
1035185906 7:157125698-157125720 GCAGTGCCCTGGGACTTATGCGG + Intergenic
1035332209 7:158103692-158103714 GCACTGACCTGGCACAGAGCAGG - Intronic
1035607359 8:938713-938735 GCTGTGGCCTGGCTGTGAGGTGG + Intergenic
1037505177 8:19522537-19522559 CCAGTGTCCTGGCACAGTGGAGG + Intronic
1037971333 8:23173987-23174009 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1039267513 8:35841793-35841815 GGGCTGGTCTGGCACTGAGGTGG - Intergenic
1039284871 8:36029000-36029022 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1039376043 8:37035144-37035166 GCAGTTGCCTGGCACATAGTAGG - Intergenic
1040329579 8:46379018-46379040 GCAGACGGCAGGCACTGAGGGGG + Intergenic
1041809035 8:61887213-61887235 GGACTGGCCTGGCACTGGGCAGG + Intergenic
1043129929 8:76447800-76447822 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1043346467 8:79303668-79303690 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1044624522 8:94223771-94223793 CCAGTGGCCTGGGAGTGAGGGGG + Intergenic
1044633469 8:94300520-94300542 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1044738700 8:95304099-95304121 GTAGTAACCTGCCACTGAGGCGG + Intergenic
1045659635 8:104423970-104423992 GCATTTGCCAGGCACTGAAGTGG + Intronic
1046375790 8:113378298-113378320 GCACAGGACTGACACTGAGGAGG - Intronic
1047740533 8:127802957-127802979 GCAGTGGGCTGGCAGTGCAGAGG + Intergenic
1048648591 8:136449973-136449995 GCAGTGGCGCGACAATGAGGAGG - Intergenic
1048757492 8:137755307-137755329 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1049336932 8:142091701-142091723 GCGAGGGCCAGGCACTGAGGTGG + Intergenic
1049455068 8:142682513-142682535 GCAGGGGACAGGCACTCAGGAGG + Exonic
1051383310 9:16480681-16480703 CCAGTGGGCTGGCACTGCTGGGG - Intronic
1052996042 9:34552084-34552106 GCAGGGGCCTGTCAGGGAGGGGG + Intronic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1053292366 9:36889698-36889720 GCACTGGCCTGGCACACAGTAGG + Intronic
1053539188 9:38955982-38956004 TCAGAGGCCTGACACTCAGGAGG + Intergenic
1054626953 9:67407937-67407959 TCAGAGGCCTGACACTCAGGAGG - Intergenic
1055049365 9:71963712-71963734 CCAGTGGGCTGGCACTGCTGGGG - Intronic
1055296182 9:74836132-74836154 GCAGTTGCCAGGAGCTGAGGGGG - Intronic
1056122598 9:83504150-83504172 GCACTGGCCTGGCCTTGAAGGGG - Intronic
1056383530 9:86077074-86077096 GCATAGGCCTGGCACAGAGTAGG + Intronic
1056515186 9:87343309-87343331 GCAGGAGCCTGGCACAGATGGGG - Intergenic
1056955282 9:91076133-91076155 CCAGTGGCCTCTCACTGAGTTGG + Intergenic
1057844949 9:98515981-98516003 GCACTGGCCTGGCCCCTAGGTGG + Intronic
1057921836 9:99104610-99104632 GCAGGGGCCTGGCGCTGCAGCGG + Intronic
1060209275 9:121700028-121700050 GCAGTGCCCAGGCCCTGAGCTGG + Intronic
1060277233 9:122191525-122191547 ACAATGGCCGGGCACTTAGGAGG - Intronic
1061068506 9:128294265-128294287 GAAGTGGCCAGGCTCTGAGTGGG + Intergenic
1061373203 9:130209517-130209539 GCACTGGCCTGGCATAGAGTAGG - Intronic
1062146208 9:134991219-134991241 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1062526631 9:136980496-136980518 GCTGGGGCCTGGCACAGAGTGGG - Intronic
1062565772 9:137163387-137163409 GGAGTGGTCTGGCACTGGGGAGG - Intronic
1185558638 X:1041156-1041178 GCAGAGGCCGGGCAGGGAGGCGG + Intergenic
1186152589 X:6690694-6690716 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1188105234 X:26141116-26141138 GCAGAGGCCAGGCACTCAGATGG + Intergenic
1189011821 X:37053558-37053580 GCAGTGGCACGGCAGTGCGGAGG + Intergenic
1189036887 X:37502729-37502751 GCAGTGGCACGGCAGTGCGGAGG - Intronic
1189638551 X:43041267-43041289 GGAATGGCCTGGGACTCAGGAGG + Intergenic
1189709416 X:43794223-43794245 CCAGTGCCAAGGCACTGAGGTGG - Intronic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1190423428 X:50309279-50309301 GAAGAAGCCTAGCACTGAGGAGG + Exonic
1191152922 X:57240545-57240567 GCAGTGGCATGGCATTGACATGG + Intergenic
1192139690 X:68637242-68637264 GCACTGTCCTGGCAATTAGGAGG - Intergenic
1192382780 X:70635753-70635775 GGGCTGGCCTGGCACTGAGTAGG - Intronic
1192382965 X:70636531-70636553 GGGTTGGCCTGGCACTGGGGTGG - Intronic
1193040199 X:76996846-76996868 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1193343764 X:80382708-80382730 GCAGCAGCCTGGCAGTGGGGGGG - Intronic
1194742931 X:97596727-97596749 GCAGTGGCCTGGCCCTTATAAGG - Intronic
1195063514 X:101219014-101219036 GCTGTGGCCTGGGACTGCTGGGG + Intergenic
1195702066 X:107713105-107713127 GCATAGGCCTGGCACTGACAGGG + Intergenic
1196761968 X:119208660-119208682 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1196762342 X:119211067-119211089 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1196775515 X:119333768-119333790 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1196781461 X:119387772-119387794 CCAGTGGGCTGGCACTGCTGGGG + Intergenic
1197271238 X:124426895-124426917 TCAGTGCCCTGCCACTGAGAGGG + Intronic
1198834358 X:140785918-140785940 GCAGTGGCCAGGAACCCAGGAGG - Intergenic
1198967688 X:142244753-142244775 GGGCTGGCCTGGCACTGAGTGGG - Intergenic
1199237743 X:145510349-145510371 GCAGTGTCCTGAGACTGAGCAGG - Intergenic
1199601220 X:149542263-149542285 GAAGTGGCCAGGCCCTGTGGGGG + Intronic
1199649157 X:149937221-149937243 GAAGTGGCCAGGCCCTGTGGGGG - Intronic
1199703435 X:150403280-150403302 GTAGTTGCCAGGGACTGAGGTGG + Intronic
1200069130 X:153519124-153519146 GCACAGGCCTGGCACAGAGTGGG + Intronic
1200135586 X:153873123-153873145 GCAGGGCCCCGGCACTCAGGAGG + Intronic
1201573037 Y:15434017-15434039 CCAGTGGGCTGGCACTGCTGGGG - Intergenic
1201592654 Y:15632468-15632490 GCATTGGCCTGGCATGGTGGTGG - Intergenic
1201765326 Y:17569358-17569380 GCACTGGCCTGCCACTGGGCCGG + Intergenic
1201836226 Y:18336631-18336653 GCACTGGCCTGCCACTGGGCCGG - Intergenic