ID: 1053001630

View in Genome Browser
Species Human (GRCh38)
Location 9:34579942-34579964
Sequence GAGGATTGCCTCAGCGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053001630_1053001637 3 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001637 9:34579968-34579990 GATCCCCAGGAAGAGGGTCAGGG No data
1053001630_1053001634 -4 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001634 9:34579961-34579983 CCTCTGAGATCCCCAGGAAGAGG No data
1053001630_1053001635 -3 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001635 9:34579962-34579984 CTCTGAGATCCCCAGGAAGAGGG No data
1053001630_1053001636 2 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001636 9:34579967-34579989 AGATCCCCAGGAAGAGGGTCAGG No data
1053001630_1053001641 25 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001641 9:34579990-34580012 GCATCTGAGCTACTGTTCACTGG No data
1053001630_1053001642 29 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001642 9:34579994-34580016 CTGAGCTACTGTTCACTGGCAGG No data
1053001630_1053001632 -10 Left 1053001630 9:34579942-34579964 CCCTGCTCGCTGAGGCAATCCTC 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1053001632 9:34579955-34579977 GGCAATCCTCTGAGATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053001630 Original CRISPR GAGGATTGCCTCAGCGAGCA GGG (reversed) Intronic
901507773 1:9696658-9696680 GAGGATTGCCTGAGCTAGGGAGG + Intronic
902529761 1:17083253-17083275 GAGGATTGCTTAAGCCCGCAAGG + Intronic
903050479 1:20596848-20596870 GAGGATCGCCTGAGCCAGGAAGG - Intronic
903238895 1:21969246-21969268 GAGGATTGCCTGAGTCAGGAAGG + Intergenic
904032648 1:27542891-27542913 GAGGATGGCCTCAGAGAGTGTGG + Intronic
904144310 1:28377739-28377761 GAGGATTGCCTGAGCCTGGAAGG + Intronic
908502008 1:64753141-64753163 AAGGATTGCTTGAGCGAGGAAGG - Intronic
914199196 1:145469835-145469857 GAGGATTGCTTGAGCGAGGGAGG - Intergenic
914478308 1:148042971-148042993 GAGGATTGCTTGAGCGAGGGAGG - Intergenic
915120134 1:153625146-153625168 GAGGATTGCCTGAGCCCGGAAGG + Intronic
918240883 1:182619186-182619208 GAGGATTGGCTGAGAGGGCAAGG - Intergenic
919264124 1:195238537-195238559 GAGGAGTGTGTGAGCGAGCATGG - Intergenic
922616462 1:226963929-226963951 GAGTAGTGCCACAGCCAGCAGGG + Intronic
922620078 1:226983728-226983750 GAGGAGGGCATCAGCGAGGAAGG - Intronic
922949559 1:229547326-229547348 GGGGATTGCCTCTGCCTGCATGG - Intronic
924113665 1:240725040-240725062 GAGGATTGCTTGAGCCAGTAAGG + Intergenic
924504093 1:244664606-244664628 GAGGATTGCCTCAGCCCAGAAGG + Intronic
1062794207 10:330900-330922 GAGGATGGCCTCAGCTTGAAAGG - Intronic
1067094395 10:43289228-43289250 GAGGATCGCCTCAGCCAGGGAGG + Intergenic
1068219006 10:54019611-54019633 GATGATTGCCTGAAAGAGCATGG - Intronic
1069159133 10:65070861-65070883 GAGAATTGCTTCAGCCAGGAAGG - Intergenic
1070127722 10:73635469-73635491 GAGGATTGCCTGAGCCAGGGAGG - Intronic
1070646498 10:78205550-78205572 GAGCCTTGCCCCAGAGAGCACGG + Intergenic
1071793811 10:88984642-88984664 GAGGCCTGGCTCAGAGAGCATGG - Intronic
1072886739 10:99283412-99283434 GAGGATTGCTTGAGCCAGGAGGG + Intergenic
1075516620 10:123113673-123113695 GAGGATTGCCTGAGCCAGGGAGG + Intergenic
1078283317 11:9924836-9924858 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1079064139 11:17275158-17275180 GAGGATTGCCTGAGCCTGCGAGG + Intronic
1079211691 11:18466562-18466584 GAGGATTGCTTCAGCCAGGGAGG + Intronic
1079227710 11:18621995-18622017 GAGGATTGTCTCAGCCAGGGAGG + Intronic
1080550747 11:33372048-33372070 TAGGATTCCCACAGCAAGCAAGG - Intergenic
1085358592 11:75864143-75864165 GAGGATCGCCTCAGCTCACAAGG - Intronic
1086912836 11:92492858-92492880 GATGACTGCCTCAGGGAGAAGGG - Intronic
1087814001 11:102638529-102638551 GAGGATTGTCTCAGCGTCCCAGG + Intergenic
1090302606 11:125658156-125658178 GAGGATTGCTTGAGCCTGCAAGG - Intronic
1091733709 12:2901200-2901222 GAGGATTGCCTGAGTCAGGAAGG - Intronic
1094139130 12:27162682-27162704 GAGGATTGCTTCAGCTAGGGAGG - Intergenic
1094191330 12:27701286-27701308 AAGGAAGGCCTCAGCGAGGAGGG + Intergenic
1094621112 12:32081507-32081529 GAGGATTGCCTGAGCATGGAAGG - Intergenic
1095402387 12:41829806-41829828 GAGGATTGCTTGAGCTAGGAAGG + Intergenic
1096996228 12:55839956-55839978 GAGGACTGGGTCAGAGAGCAGGG - Intronic
1099058426 12:77874306-77874328 GAGGATTGCTTGAGCCTGCAAGG - Intronic
1101450621 12:104775247-104775269 GAGGATTGCCTGAGCTAGGGAGG - Intergenic
1102267145 12:111496062-111496084 GAGGATTGCTTGAGCCAGGAAGG + Intronic
1103503219 12:121421461-121421483 GAGGATTGCTTGAGCCTGCAGGG + Intronic
1105042000 12:132967916-132967938 GAGGAGTGTGTGAGCGAGCATGG - Intergenic
1106242136 13:27920771-27920793 GAAGATGGGCTCAGCGAACAGGG - Intronic
1107081099 13:36375641-36375663 GAGGATTGCTTGAGCGATCTGGG - Intergenic
1108495833 13:51024593-51024615 GAGAGTTGTCTCAGAGAGCAAGG - Intergenic
1110249859 13:73369608-73369630 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
1110711707 13:78657890-78657912 AAGGATGGCCTCATCGAGGATGG - Intronic
1111482991 13:88856564-88856586 GTGTATTGCTTCAGAGAGCATGG - Intergenic
1115518441 14:34208817-34208839 GAGCATCTCCTCAGAGAGCAGGG - Intronic
1118178792 14:63470159-63470181 GAGGATTGCTTCAGCCAGGGAGG - Intronic
1118735786 14:68701074-68701096 GAGGAGAGCCTCATAGAGCAGGG - Intronic
1119870225 14:78010790-78010812 GAGGATTGCATGAGTGAGCATGG + Intergenic
1121433068 14:93900864-93900886 GAAGATTGCCCCAGAGAGGAGGG - Intergenic
1122626887 14:103089509-103089531 GAGGCTGGGCTCTGCGAGCAGGG - Intergenic
1123939180 15:25208526-25208548 GAGAGTTTCCTCAGGGAGCAGGG + Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1127802765 15:62491948-62491970 GAGAATTGCGGCAGGGAGCAGGG + Intronic
1129640939 15:77377292-77377314 GAGGATTGCTTAAGCCAGAAAGG + Intronic
1129778859 15:78255946-78255968 GAGGATTGCTTGAGTGAGCTGGG - Intergenic
1131041178 15:89268182-89268204 GAGGATTGCTTCAGCCCGGAAGG - Intronic
1135668315 16:24354101-24354123 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1137308092 16:47224907-47224929 GAGGATTGCCTCAGCCTGGGAGG + Intronic
1137378387 16:47974867-47974889 GAGGATTGCCTGAGCCAGAGCGG + Intergenic
1138252232 16:55509767-55509789 GAGGATGGTCTGAGCGGGCACGG + Intronic
1146208596 17:30924510-30924532 GAGGATACCCTCAGCCTGCATGG + Intronic
1147778854 17:42924995-42925017 CAGGTGAGCCTCAGCGAGCAAGG - Intergenic
1148009169 17:44461781-44461803 GAGGATTGCCTGAGCCCGGAAGG - Intronic
1148030773 17:44619324-44619346 GAGGATTGCTTGAGCCAGGAAGG - Intergenic
1148155438 17:45422325-45422347 GAGAATTGCCTCAGCCAGGGAGG + Intronic
1150130894 17:62668260-62668282 GAGGATTGCTTGAGCCTGCAAGG + Intronic
1150387126 17:64770971-64770993 GAGAATTGCCTCAGCCAGGGAGG + Intergenic
1151761877 17:76108935-76108957 GAGGATTGCCTGAGCTTGGAAGG + Intronic
1156727597 18:40148091-40148113 GAAGATTGCCTCCTAGAGCAGGG - Intergenic
1157279362 18:46335555-46335577 GAGGAGGGCCTGAGCCAGCAGGG - Intronic
1162211342 19:9094627-9094649 GAGGATTGCTTCAGCCAGGGAGG - Intergenic
1162803877 19:13126510-13126532 GAGGAATTCCCCAGCCAGCATGG - Intronic
1163404198 19:17112418-17112440 GAGGCTGGCTTCAGGGAGCAGGG + Intronic
1165196136 19:34105359-34105381 GAGGATCGCCTGAGCCAGGAAGG - Intergenic
1167626023 19:50589913-50589935 GAGGATTGCTTGAGCCAGCGAGG - Intergenic
925288740 2:2732380-2732402 TAGGATGGCCTCAGACAGCAAGG + Intergenic
925997864 2:9306679-9306701 GACAATTCCCTCAGCGAGCCAGG - Intronic
926577491 2:14598145-14598167 GAGGATTAGATGAGCGAGCATGG - Intergenic
928316578 2:30251142-30251164 GAGGATTGCCTGAGCCTGGAAGG - Intronic
931894187 2:66711260-66711282 GAGGATTGCTTGAGCCAGCGAGG - Intergenic
932378782 2:71262802-71262824 GAGGATTGATTGAGCCAGCAAGG - Intergenic
932522573 2:72428533-72428555 GAGGAGTGTATGAGCGAGCATGG - Intronic
932602686 2:73139401-73139423 GAGGATTGCTTGAGCCAGCCTGG - Intronic
932775147 2:74524081-74524103 GAGGATTGCCCCAGAAAGCTCGG + Exonic
933252691 2:80046657-80046679 CAGGAGTGCCTCAGCAACCAAGG + Intronic
934086396 2:88513398-88513420 GAGGATTGCCTGAGCCAGGGAGG + Intergenic
934856804 2:97734857-97734879 GAGGATTCCCTGAGAGAGCTCGG + Intronic
936456861 2:112681903-112681925 GAAGATTCCCTCAGCGGTCAGGG - Intergenic
938092005 2:128440471-128440493 GAGGACGGCCCCAGTGAGCAAGG + Intergenic
939797736 2:146667739-146667761 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
940886177 2:158991000-158991022 GAGGATTGCTTGAGCCAGCGAGG + Intronic
942548774 2:177092599-177092621 GAGGATTGCCTGAGCGTGGGAGG - Intergenic
946552464 2:220817674-220817696 GAGGACTGCTTCAGCCAGGAAGG - Intergenic
948433361 2:237934835-237934857 GAGGATTGCCTGAGCCCACAAGG + Intergenic
948452830 2:238088000-238088022 GAGGATTGCTTGAGTGAGCGTGG + Intronic
1168849885 20:969224-969246 GAGGATCGCCTGAGCGGGGAAGG + Intronic
1168964169 20:1889122-1889144 GCTGATTGCCTCAGCCATCACGG - Intergenic
1169218464 20:3806821-3806843 GAGGATTTCCTCAGAGATCTGGG - Intergenic
1171121664 20:22573719-22573741 GAGGATTTTCTCAACTAGCAGGG + Intergenic
1174010235 20:47443697-47443719 GAGGATTGCTTGAGCCAGGAAGG + Intergenic
1178432852 21:32531735-32531757 GAGGATTGCTTCAGCCAGGGAGG + Intergenic
1178882084 21:36457641-36457663 GAGGATTGCTTGAGCCAGCCCGG + Intergenic
1178943476 21:36926830-36926852 GAGGATTGCCTGAGCCAGGGAGG - Intronic
1179984569 21:44913447-44913469 CAGGATTGGCTCAGAGACCACGG + Intronic
1182284340 22:29235877-29235899 GAGGATTGCCTGAGCCAGGGAGG - Intronic
1182631642 22:31690572-31690594 GAGGATTGCTTCAGCCAGGAAGG - Intronic
1183844199 22:40527034-40527056 GAGGATTGCTTGAGCCAGGAAGG + Intronic
952305656 3:32143890-32143912 GAGGATTGCTTCAGCGTGGGAGG + Intronic
955274821 3:57537102-57537124 GAGGATTGCTTGAGCCAGGAAGG + Intronic
955897123 3:63712382-63712404 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
956769628 3:72513728-72513750 GAGGATTACCTGAGCCTGCAAGG + Intergenic
960391429 3:117081793-117081815 GAGGATTGCTTGAGCCAGGAAGG + Intronic
960836096 3:121908332-121908354 GAGCATTGCCTCACCCAGGAAGG - Intronic
962607717 3:137046130-137046152 GAGGATTGCCTCAGCTGGAAAGG + Intergenic
963648230 3:147944263-147944285 GAGGATGGCTTCAGCCAGAAAGG + Intergenic
966884076 3:184365579-184365601 GAGGATTGCCTGAGCCAGGGAGG + Intronic
967515127 3:190359716-190359738 GAAGAGTGCTTCAGCGAGCCAGG + Intronic
968636216 4:1681584-1681606 GAGGATTGCTTCAGCCAGGGAGG - Intronic
971409081 4:26351468-26351490 GAGGATTGCCTGAGCCTGCAAGG - Intronic
977938368 4:102830774-102830796 GAGGATTGCCTCAGCCTGGGAGG + Intronic
981788654 4:148509925-148509947 GAGGATTGCTTGAGCCTGCAAGG + Intergenic
984634494 4:182096038-182096060 GAGGATTGCCTGAGCTAGGGAGG + Intergenic
987304250 5:16622868-16622890 GAGGATTGCTTGAGCCAGGAAGG + Intergenic
990607171 5:57422801-57422823 GAGGATGGCCACAGGGAGAATGG + Intergenic
1001926967 5:175644671-175644693 GAGGATTGCTTGAGCCTGCAAGG + Intergenic
1002111158 5:176913885-176913907 GAGGATCGCCTGAGCCAGGAGGG + Intronic
1005121766 6:22398208-22398230 GAGGATTGCTTGAGCCAGCGTGG - Intergenic
1007050319 6:38821651-38821673 GAGGATTGCTTCAGCCAAGAAGG - Intronic
1007486995 6:42187508-42187530 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1007549147 6:42715828-42715850 GTGCATTGCCTCAGTAAGCATGG - Intronic
1011611437 6:89155362-89155384 GAGGATTGCTTCAGCCTGGAAGG - Intronic
1017431912 6:154379653-154379675 GAGGATTGCCTCAGCCTGAAAGG + Intronic
1018194795 6:161345860-161345882 GAGGATGAGATCAGCGAGCATGG + Intergenic
1018619344 6:165715063-165715085 GAGTATTGGCTCAGCCTGCAGGG + Intronic
1019985011 7:4649174-4649196 GAGGACTGCCTCAGTCAGCCTGG - Intergenic
1020126330 7:5534317-5534339 GAGCATTGCTTCAGCGTGGAAGG + Intronic
1021626239 7:22595724-22595746 CAGGATTGCCTCACCCTGCAGGG - Intronic
1022487735 7:30793503-30793525 GAGGATTGCCTGAGCGTGGAAGG - Intronic
1023850185 7:44146033-44146055 GAGGATGGCCACGGCGGGCAGGG + Intronic
1026124267 7:67565767-67565789 GAGGATCGCTTGAGCCAGCAAGG - Intergenic
1029634421 7:101774414-101774436 GAGGATTGCTTGAGCTAGGAAGG + Intergenic
1029902622 7:104058156-104058178 GAGGATTGCTTGAGCCCGCAAGG + Intergenic
1029988289 7:104940931-104940953 GAGGATTGCCACTGCCAGCTGGG - Intergenic
1036948387 8:13117386-13117408 GAGGATTGCTTCAGCTTGGAAGG + Intronic
1037244486 8:16817301-16817323 GAGGATTGCCTTAGCCAGGGAGG - Intergenic
1038704549 8:29881417-29881439 CAGGAGTGCATCAGCAAGCAGGG + Intergenic
1039252207 8:35679158-35679180 GAGGATTGCTTCAGCCTGGAAGG + Intronic
1042917497 8:73889867-73889889 GAGGATTGCTTCAGCCTGAAAGG + Intergenic
1045350243 8:101331586-101331608 GAGGATTGCCTGAGCATGGAAGG + Intergenic
1045428753 8:102093548-102093570 GAGGATTGACTCAGCTAGGAGGG + Intronic
1048355476 8:133650357-133650379 GAGGGAGGTCTCAGCGAGCAAGG + Intergenic
1049851235 8:144831923-144831945 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1050523445 9:6525336-6525358 GAGGATTGCTTGAGCCAGGAAGG + Intergenic
1053001630 9:34579942-34579964 GAGGATTGCCTCAGCGAGCAGGG - Intronic
1055839065 9:80480946-80480968 GAGTAATGCCACAGTGAGCATGG + Intergenic
1057084074 9:92192586-92192608 GAGGATTGCCTGAGCCTGGAAGG - Intergenic
1059536004 9:115081497-115081519 TAGGATGGCCTCAGCCAGGATGG - Intronic
1060997347 9:127882714-127882736 GGGGATTGCCCCAGGGAGCCTGG + Intergenic
1061607933 9:131725546-131725568 GAGGATTGCTTTAGCCCGCAAGG - Intronic
1189504509 X:41598047-41598069 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1189508519 X:41637731-41637753 GAGGATTGCCTGAGCCAGGGAGG - Intronic
1192377703 X:70581089-70581111 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1194572331 X:95568109-95568131 GTAGATTGCTTCAGGGAGCATGG - Intergenic
1195087776 X:101428959-101428981 GAGGATTGCCTGAGCCCGAAAGG - Intronic
1195674014 X:107493088-107493110 GAGGATTGCTTGAGCCAGGAAGG + Intergenic
1199187873 X:144938585-144938607 GAGGGGTGCGTGAGCGAGCATGG + Intergenic