ID: 1053002450

View in Genome Browser
Species Human (GRCh38)
Location 9:34584784-34584806
Sequence GATTCTGTGGCAGAGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002450_1053002454 8 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002454 9:34584815-34584837 TGCTCTGCCCCAGCCTCCTCTGG No data
1053002450_1053002460 25 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002450_1053002461 29 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002450 Original CRISPR GATTCTGTGGCAGAGGTCAG AGG (reversed) Intronic