ID: 1053002450

View in Genome Browser
Species Human (GRCh38)
Location 9:34584784-34584806
Sequence GATTCTGTGGCAGAGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002450_1053002460 25 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002450_1053002454 8 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002454 9:34584815-34584837 TGCTCTGCCCCAGCCTCCTCTGG No data
1053002450_1053002461 29 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002450 Original CRISPR GATTCTGTGGCAGAGGTCAG AGG (reversed) Intronic
900489602 1:2940615-2940637 GCTTCTGGGGCAGAAATCAGAGG - Intergenic
900818996 1:4871890-4871912 GAATCTGTGGTTCAGGTCAGAGG + Intergenic
900825294 1:4921315-4921337 CTTTCTGGGGCAGAGCTCAGGGG - Intergenic
900837367 1:5015589-5015611 GCTACTGTGGCAGAGGGGAGTGG - Intergenic
900989003 1:6089339-6089361 GATACTGTGGCAGAGGCATGGGG - Intronic
903674908 1:25057480-25057502 GCCTCAGTGGCAGAGGGCAGTGG - Intergenic
903843240 1:26259918-26259940 GATTCTGTGTGAGAAGCCAGTGG - Intronic
904255379 1:29251351-29251373 GGTCATTTGGCAGAGGTCAGGGG + Intronic
904823712 1:33261227-33261249 GGTTTTTTGGCAGAGATCAGAGG - Intronic
905785882 1:40757232-40757254 CGTTCTGTGTCAGTGGTCAGGGG + Intronic
905893934 1:41533312-41533334 GAAGCTGTGGGAGAGGACAGTGG - Intronic
906322267 1:44824374-44824396 TATTCTCTGGCAGAGGAAAGGGG - Intronic
907048191 1:51312804-51312826 GATGCTGTGTCAGAGGTTGGGGG - Exonic
908828216 1:68153720-68153742 GCTTTTGTGGGAGAGGTAAGTGG + Intronic
910961407 1:92767790-92767812 GATTTTTTGGCAGAGCACAGTGG + Intronic
912969860 1:114270544-114270566 GATTCTCTGCCAGAGGGAAGAGG - Intergenic
912986677 1:114440142-114440164 GATTCTGTGGAAGAGGAGGGGGG + Intronic
913591260 1:120328724-120328746 GATTCTGTGGGAGAGGATACTGG - Intergenic
913652105 1:120926375-120926397 GATTCTGTGGGAGAGGATACTGG + Intergenic
914169002 1:145202695-145202717 GATTCTGTGGGAGAGGATACTGG - Intergenic
914524123 1:148446650-148446672 GATTCTGTGGGAGAGGATACTGG - Intergenic
914599553 1:149189221-149189243 GATTCTGTGGGAGAGGATACTGG + Intergenic
914642283 1:149620486-149620508 GATTCTGTGGGAGAGGATACTGG + Intergenic
915918063 1:159953068-159953090 GATGCAGTGGCAGGGATCAGGGG - Intronic
924573315 1:245257688-245257710 GCTTAGGTGGCAGAGGACAGGGG + Intronic
924651186 1:245928720-245928742 GATCCTATGGGAGAGGTCAGTGG - Intronic
1064265380 10:13821273-13821295 GGTTCTGTGGCAGGGGACACAGG + Intronic
1064845152 10:19643878-19643900 GATGCACTGGCAAAGGTCAGAGG + Intronic
1065858047 10:29846534-29846556 TATTCTGTGCCACAGATCAGAGG + Intergenic
1067059266 10:43069559-43069581 GAGTCTGGGGCAGAGGAGAGAGG + Intergenic
1067700960 10:48571693-48571715 GATACCGTGGCAGGGATCAGTGG + Intronic
1070573848 10:77662071-77662093 GATTCCGTTGCAGAAGTCTGTGG - Intergenic
1072345038 10:94496336-94496358 GATTCTGAGGCAAAAGTTAGAGG - Intronic
1074714022 10:116201818-116201840 GAGTAGGTGGCAGAGGTGAGGGG - Intronic
1075077155 10:119359175-119359197 GAGACTGTGCCAGAGGCCAGGGG + Intronic
1075098182 10:119487415-119487437 GATTCTGTGGCAGAGTTGGGAGG - Intergenic
1075295376 10:121270613-121270635 GAGTCTGTGGAGGAGGTCAGAGG + Intergenic
1076342087 10:129756250-129756272 GCTTCTGTGGCTGGGGTCAAGGG - Intronic
1076554149 10:131311340-131311362 GAGTCTGGCGCAGAGGGCAGCGG + Exonic
1076730259 10:132435795-132435817 GAGGCTGTGGCAGTGGGCAGAGG - Intergenic
1076764530 10:132625699-132625721 CTTTCTTTGGCTGAGGTCAGGGG + Intronic
1077240760 11:1509227-1509249 GATTCTCTGGCTGAGGCCCGAGG - Intergenic
1077922623 11:6653134-6653156 GAGTCTGTGGGAGAGGTAAATGG - Intronic
1079091622 11:17484597-17484619 GATTCTGTGGGAGAGGAGGGAGG + Intergenic
1079097981 11:17523132-17523154 GAGTGTGTGGCAGAGATCAAAGG + Intronic
1079705288 11:23608380-23608402 GAATCCCTGACAGAGGTCAGTGG + Intergenic
1080075912 11:28149358-28149380 GTTTGTGTGGCAGGGGTGAGTGG + Intronic
1080642879 11:34168051-34168073 GTTTCTGGGGCAGAGGCCTGTGG - Intronic
1080698642 11:34625003-34625025 GATTCTGTGGCTGTGGTGATTGG + Intronic
1080824134 11:35833595-35833617 GATTTTGTGTCAGCGGTCAGTGG - Intergenic
1080880826 11:36318853-36318875 AATTATGTGGCAAATGTCAGAGG + Intronic
1081653168 11:44839236-44839258 GATGCAGTGGAAGGGGTCAGGGG + Intronic
1081784135 11:45734384-45734406 GATTCAGTATCAGAGGACAGAGG + Intergenic
1082706569 11:56499831-56499853 GCTACTGTGGCAGGGGTGAGGGG + Intergenic
1083259009 11:61513193-61513215 GATTCAGGGGCAGAGGCCAAGGG + Intergenic
1084084116 11:66847008-66847030 TCCTCTGGGGCAGAGGTCAGAGG - Intergenic
1085571216 11:77559473-77559495 GAGTCTGAGGCAGTGGTCTGTGG + Intronic
1086455773 11:86956967-86956989 AATTCTGTGGCATATGGCAGAGG + Intergenic
1087166818 11:95012928-95012950 GCTTCTGTAGTTGAGGTCAGAGG - Intergenic
1088915971 11:114228094-114228116 GATTCTGAGGAAGAGTTCAGGGG - Intronic
1089076343 11:115741756-115741778 GATTCTGTGGCAGGGATAAAGGG + Intergenic
1089692960 11:120198040-120198062 AGTTCTGTAGCAGAGGACAGAGG + Intergenic
1091050657 11:132367204-132367226 GATTGTGTAGCAGAGATCTGGGG + Intergenic
1091688128 12:2578253-2578275 GGTTCTTTGGCAGACGTCAGTGG - Intronic
1092726248 12:11488323-11488345 GACTCTGTGTAAGAGATCAGAGG + Intronic
1094294573 12:28889873-28889895 GTTTGTGTGGCAGGGGGCAGGGG - Intergenic
1095430520 12:42129065-42129087 GATACAGTGGCAGAGGAGAGTGG - Intronic
1096597591 12:52706596-52706618 GATTCTGAGTCAGATATCAGAGG + Intergenic
1098394416 12:70003078-70003100 GGCTCTGTGGCAGAGGAGAGAGG + Intergenic
1100231488 12:92612758-92612780 GTGTCAGTGGCAGAGGTTAGAGG - Intergenic
1101962115 12:109258350-109258372 GATTCTGAGGCCAAGGTGAGGGG + Exonic
1102024693 12:109707605-109707627 GATTCTGAGGCTGGGGTCACTGG - Intergenic
1102251568 12:111390912-111390934 GTGTCTGTGGCAGGGGTCTGGGG - Intergenic
1102656812 12:114489043-114489065 AATACAGTGGCAGAGGCCAGAGG + Intergenic
1102993768 12:117333022-117333044 GATGCTGTGGCCCAGGTGAGGGG + Intronic
1103943430 12:124513138-124513160 CTTTCTGTGGCTGGGGTCAGAGG - Intronic
1105890265 13:24677565-24677587 ATTTCTGGGGCAGAGGTGAGCGG + Intergenic
1106691108 13:32117748-32117770 GACTCAGTGGGAGAGGGCAGAGG - Intronic
1108747311 13:53408939-53408961 GATTCTGTGGCAGAAGTGGCAGG + Intergenic
1109344221 13:61095445-61095467 GGGTTTGTGGCAGAGGTCAGTGG + Intergenic
1112990552 13:105508421-105508443 CATTCTGTTGCAGAGGTGAAAGG + Intergenic
1113129871 13:107023758-107023780 GACCCTGTGGGAGAGTTCAGAGG + Intergenic
1113130019 13:107025717-107025739 GACCCTGTGGGAGAGTTCAGAGG - Intergenic
1113485059 13:110647093-110647115 GATGCTGTGGGAGAGGTAAGAGG - Exonic
1113802810 13:113095348-113095370 GTCTCTGTGGGAGAGGCCAGAGG - Intronic
1116131248 14:40857297-40857319 GATTCTGTGGCAGAGGTTCTGGG + Intergenic
1116521135 14:45848499-45848521 TATTCTATGGCAGAGGTGAAAGG - Intergenic
1118166502 14:63341425-63341447 GAAGCTGAGGCAGAGGTGAGAGG + Intergenic
1119451702 14:74717477-74717499 GATTGGGTGGCAATGGTCAGGGG + Intronic
1119897347 14:78231282-78231304 GGGACTTTGGCAGAGGTCAGGGG + Intergenic
1120343703 14:83255727-83255749 GACTCTGTGACAGAGACCAGGGG + Intergenic
1120635222 14:86943056-86943078 GCCTCTGTGGCAGAAGTCATTGG + Intergenic
1122346821 14:101066084-101066106 GATTCAATGGCGGGGGTCAGGGG - Intergenic
1124226646 15:27900916-27900938 GAAGTGGTGGCAGAGGTCAGGGG + Intronic
1125502098 15:40246213-40246235 GATTCTGGGGCAAAGGGTAGGGG + Intronic
1125601008 15:40915775-40915797 GAGACTGTGGCAGTGGGCAGCGG + Intergenic
1127908149 15:63392500-63392522 GGATCTAAGGCAGAGGTCAGAGG + Intergenic
1128978730 15:72171084-72171106 GATTTTGTGGGTGAGGTCACTGG - Intronic
1129869455 15:78931387-78931409 GATCCTGTCGAAGCGGTCAGTGG + Intronic
1131440433 15:92455455-92455477 GCTTCTGTGGAGGAGGACAGGGG - Intronic
1133036214 16:3035741-3035763 GATTGTCTGGCAGAGGCCAAAGG - Intronic
1135299920 16:21317459-21317481 GATTTTGTGCCACAGGTCAGTGG + Intergenic
1137325185 16:47427367-47427389 GATTCTGTGGCTGGGCGCAGTGG + Intronic
1137542360 16:49373614-49373636 GAGGCTGTGGCAGAGTCCAGAGG + Intergenic
1138572917 16:57887272-57887294 GATACTGTTGCAGAGGTTAGAGG - Intronic
1138981861 16:62279472-62279494 GATGCTGAAGCAGAAGTCAGAGG + Intergenic
1141660818 16:85440602-85440624 GATTCCCTGGCTGGGGTCAGTGG + Intergenic
1142869250 17:2809635-2809657 GGTCCTGTGGAAGAGGCCAGAGG + Intronic
1143069260 17:4276737-4276759 GATTCTGAGGCAGAGATTTGAGG + Intronic
1144736898 17:17560422-17560444 GAGGCTGTGGCAGAGGTTATCGG + Intronic
1146268265 17:31467573-31467595 CATTCTGAGGCTGAGATCAGTGG - Intronic
1146691430 17:34878900-34878922 GGTTCTGTGGCCGGGGGCAGAGG - Intergenic
1148007952 17:44449488-44449510 GATTCTGAGGCTGAGTGCAGGGG - Intronic
1148469150 17:47882756-47882778 TCTTCTGTAGCAGAGGGCAGAGG + Intergenic
1148779540 17:50113548-50113570 GATTCTGTCTCAGAGGCTAGTGG - Intronic
1149150391 17:53555467-53555489 AATTCTGGAGGAGAGGTCAGTGG + Intergenic
1149908443 17:60548323-60548345 GATTCTGTGGCAGGGCGCAGTGG - Intergenic
1151770731 17:76158924-76158946 GTTTCTGTGGCAGAGTAAAGGGG - Intronic
1153791882 18:8586418-8586440 GATGCTGGGGCAGAGGTGATGGG + Intergenic
1154393853 18:13969119-13969141 GAATTTGGGGCAGAGGTCGGGGG + Intergenic
1154956277 18:21258681-21258703 AATTCTGTGGCAGAGGTGAAGGG + Intronic
1156083748 18:33374230-33374252 GATTCTATGCCATATGTCAGAGG - Intronic
1157579586 18:48765578-48765600 CATTCTGCAGCAGAGGTCTGAGG + Intronic
1162549295 19:11349741-11349763 GATGCTGGGGCAGAGGGTAGAGG - Intronic
1164670040 19:30067253-30067275 GACTCTCTGGCAGAGTGCAGGGG - Intergenic
1165820743 19:38674144-38674166 GATTGTGTGGGAGCTGTCAGGGG + Intronic
1166423750 19:42657669-42657691 GTTTCAGTGGCAGAGGTCTAAGG + Intronic
1166539962 19:43598803-43598825 GAATGTGGGGGAGAGGTCAGGGG - Intronic
1166665930 19:44680469-44680491 GATTATGTGGGTGAGTTCAGGGG - Intronic
1166701800 19:44886371-44886393 GATTCCATGGGGGAGGTCAGGGG + Intronic
1166791711 19:45402679-45402701 GACTCGGAGGCAGAGGTCAGGGG - Intronic
1167775207 19:51550148-51550170 GATCCTGGGGCTGAGGGCAGGGG - Intergenic
926718776 2:15943265-15943287 GACTCTCTGGCCCAGGTCAGGGG + Intronic
927038339 2:19203779-19203801 CATCCTGTGTCAGAGGTGAGAGG - Intergenic
927721852 2:25388175-25388197 GTTTCTGGAGCAGAGTTCAGCGG - Intronic
929996490 2:46829311-46829333 GTCTCTGTGGCAGAAGCCAGAGG - Intronic
931938293 2:67223026-67223048 GAATCTGGGGCAGGGCTCAGAGG - Intergenic
932088725 2:68785870-68785892 AATTATGTGCCTGAGGTCAGAGG + Intronic
933694757 2:85209611-85209633 GATTCTGAAGCAGGGGTCTGTGG - Intronic
936937541 2:117852709-117852731 GACACTGAGGCAGAGGTAAGTGG + Intergenic
938580011 2:132637349-132637371 GCTTCTGTGGCACATTTCAGAGG + Intronic
938928415 2:136065116-136065138 GATTCTGTGGAAGATTTCATTGG + Intergenic
940928246 2:159393166-159393188 GAGTGAGAGGCAGAGGTCAGTGG + Intronic
945027676 2:205634588-205634610 GATTCAATGGCAGAGGTTTGGGG + Intergenic
945975822 2:216269937-216269959 GAGTATGTGGCTGAGGACAGAGG - Intronic
946421402 2:219567161-219567183 GAAGGTGTGGCAGAGGGCAGAGG + Intronic
947859560 2:233348976-233348998 TGTGCTGTGGCAGAGGACAGGGG - Intergenic
1169206234 20:3741816-3741838 GATTCTGTGGCAGAGAGGAGAGG - Intronic
1169253268 20:4076885-4076907 GATGCTGTTGCAGAAGTCATAGG + Intergenic
1171106151 20:22434722-22434744 GATTCTGTTGATGACGTCAGTGG + Intergenic
1172284519 20:33731676-33731698 GATTCTGTGTCAGAGCTGGGGGG + Exonic
1173298587 20:41781056-41781078 GATTCTGATGCAAAGGTCATGGG + Intergenic
1173738468 20:45378413-45378435 GTGTATGTGGCAGAGGTGAGGGG + Intronic
1174325293 20:49774059-49774081 GCTTCTGGGGCTGAGGCCAGGGG - Intergenic
1178176933 21:30112562-30112584 GCCTCTATGGCAGAGCTCAGAGG + Intergenic
1179127023 21:38599543-38599565 GAACCAGAGGCAGAGGTCAGTGG + Intronic
1179479479 21:41668509-41668531 GATTCTGTGAAACAGGACAGAGG - Intergenic
1179533819 21:42038638-42038660 GATTGTGGGGCTGAGGGCAGGGG - Intergenic
1179978818 21:44885862-44885884 GCCTGTGTGGCAAAGGTCAGCGG + Intergenic
1180752110 22:18131522-18131544 GATTCCGGGGCAGGGGTGAGCGG + Exonic
1181274183 22:21678062-21678084 GATGTGGTGACAGAGGTCAGGGG + Intronic
1181980982 22:26766227-26766249 GATGCTGGGGCAGAGTTTAGCGG - Intergenic
1182028535 22:27139031-27139053 GATGCTGTCACAGAGGACAGGGG + Intergenic
1182347728 22:29678388-29678410 GAAGCTGGGGCAGAGGTGAGAGG + Intronic
1183218426 22:36496240-36496262 AGTGCTGTGGCAGAGGTGAGGGG + Intronic
1183588535 22:38767084-38767106 GATACCCTGGCAGAGGGCAGGGG + Intronic
1185098434 22:48824369-48824391 GATTCTAAGGCAGAGATCACCGG - Intronic
950409533 3:12826273-12826295 GATTCGGGGGCAGAGGTTAAAGG + Intronic
956521610 3:70110319-70110341 GAGTCTGTGGCAGATAGCAGGGG - Intergenic
956636677 3:71371819-71371841 GATGGTGTGGGAGAGGTTAGGGG - Intronic
959262413 3:104098774-104098796 GTTTCTGTGGGTGGGGTCAGAGG - Intergenic
961182120 3:124886163-124886185 GATTCTGGAGCAGAGGACAGGGG - Intronic
962827117 3:139108128-139108150 GATTGTGGGGGAGAGGGCAGTGG + Intronic
962841601 3:139237868-139237890 GATTCTGAGGCAGATGTGATGGG - Intronic
963274227 3:143314358-143314380 CACTCTGTGGGACAGGTCAGAGG - Intronic
964369129 3:155981214-155981236 GAGTTTGTGGCAGGGGTCGGGGG + Intergenic
966496010 3:180581638-180581660 TATACTGGGGCAGGGGTCAGGGG - Intergenic
968627024 4:1630335-1630357 GCTGCAGTGGCAGAGGTGAGTGG - Intronic
970926093 4:21454100-21454122 GATTCTGAGGCAATGGTCTGAGG - Intronic
971219489 4:24691837-24691859 CATTCTGGGGAACAGGTCAGCGG + Intergenic
973835119 4:54801918-54801940 GATTCTGAGCCAGAGGTCAGTGG - Intergenic
976734945 4:88299944-88299966 CATTGTGTGGCAGAGAACAGTGG + Intergenic
978155329 4:105483379-105483401 GATTCTGAGGCAGAGTTTCGGGG + Intergenic
979068981 4:116176929-116176951 GATTCTGTGGAAGGGCTAAGAGG + Intergenic
979521499 4:121672814-121672836 TCTTCTGTGGCACAGTTCAGTGG - Intronic
980162822 4:129186299-129186321 TATTCTGTTTCAGTGGTCAGTGG + Intergenic
981816041 4:148831364-148831386 CATTGTGTGGCAGAGGTCAAAGG + Intergenic
982362161 4:154530644-154530666 TATTTTTTGGCAGGGGTCAGTGG - Intergenic
983710987 4:170715074-170715096 GCATCTGTGGCATAGTTCAGAGG - Intergenic
987079413 5:14412875-14412897 GCTGCTGAGGCAGAGGCCAGAGG - Intronic
989984368 5:50680129-50680151 GATTCTGTGGGAGAGGATACTGG + Intronic
993638980 5:90379988-90380010 GAGGCTGTGGCAGAGGCCAGGGG - Intergenic
994466020 5:100132440-100132462 GATTCTGTGTAAGAGGTATGAGG - Intergenic
995636598 5:114200772-114200794 AGTTCTTTGGCAGTGGTCAGTGG + Intergenic
997109942 5:131064126-131064148 ACTTCTGTGGCAGATGACAGAGG - Intergenic
997148942 5:131470735-131470757 GACTCTGTGGCAGAGGGAGGTGG + Intronic
997370080 5:133353959-133353981 GAGACTGGGGCAGAGGTCAAGGG + Intronic
997756361 5:136403217-136403239 GATTCTGTAGCAGAGGGCGTGGG + Intergenic
998622460 5:143810148-143810170 GATTCTGAGACAGAGTCCAGGGG + Intergenic
1001192547 5:169644108-169644130 GATTCTCTGAGAGAGGTCATAGG + Intronic
1001592401 5:172874409-172874431 GATTCTGAGGCAGTGGTCCTTGG + Intronic
1003173721 6:3739456-3739478 GCCTGTGTGGCTGAGGTCAGTGG - Intronic
1005686315 6:28256176-28256198 CTTTCTGAGGCTGAGGTCAGAGG + Intergenic
1006397937 6:33799164-33799186 GAGTGTATGGCAGAGGTCTGGGG - Exonic
1006918673 6:37613451-37613473 AATTCTGTGGCAGAGGAGACGGG - Intergenic
1009706002 6:67252858-67252880 GCTTCTGTGGCACAGATCTGTGG - Intergenic
1010221687 6:73453503-73453525 GTTTCTGTGGCAGGGCACAGTGG - Intergenic
1011065919 6:83325831-83325853 AATTCTGTGAAGGAGGTCAGTGG - Intronic
1011129937 6:84042398-84042420 GATTCTGAAGCAGAGGCCAAAGG + Intronic
1011531250 6:88323660-88323682 AATTCTGAGCCAGAGGTCACAGG - Intergenic
1014715640 6:124861722-124861744 GTTTCTGTGAAAGAGGTCTGTGG - Intergenic
1018864341 6:167735386-167735408 AGTTCAGTGGCAGAGGTCAGTGG - Intergenic
1018864387 6:167735555-167735577 AGGTCAGTGGCAGAGGTCAGTGG - Intergenic
1018864418 6:167735711-167735733 AGGTCAGTGGCAGAGGTCAGTGG - Intergenic
1019446319 7:1073449-1073471 GATGCTGTGGCAGATTCCAGCGG - Intronic
1020057523 7:5128260-5128282 GTCACTGTGGCAGAGGTCAAGGG + Intergenic
1020114207 7:5466627-5466649 GGTTCTGTGGCAGAGGGGAACGG - Intronic
1020793744 7:12658542-12658564 GAGTTTATGGCAGAGTTCAGAGG + Intergenic
1020961367 7:14807673-14807695 GCTTCTGTGGCAGAGAAGAGAGG - Intronic
1021862224 7:24917161-24917183 TATTCTATAGCAGAAGTCAGTGG + Intronic
1022319607 7:29276426-29276448 GATTCTGTGGCAGGCATCACTGG + Intronic
1022574272 7:31482559-31482581 TATTCTGAGCCTGAGGTCAGAGG + Intergenic
1022836632 7:34122864-34122886 GATTCGTTTGCAAAGGTCAGGGG + Intronic
1023362672 7:39432261-39432283 GCTTCTGTGGCAGGTGGCAGGGG - Intronic
1023866944 7:44242829-44242851 GGGTGTGGGGCAGAGGTCAGGGG - Intronic
1024293048 7:47819860-47819882 GATTTTTTGGCAGAAGTGAGTGG - Intronic
1025016441 7:55442709-55442731 AATACAGTGGCAGAGGGCAGAGG + Intronic
1026995005 7:74609952-74609974 GATTCTGGGGCTGAGGTTGGGGG - Intergenic
1027511775 7:79091720-79091742 GCTACAGTGGCAGAGTTCAGTGG - Intronic
1027629499 7:80585013-80585035 GATACTGTGGCACAGGACAAAGG + Intronic
1028206235 7:88020638-88020660 GATGCAGTGGAAGAGGTCAAAGG - Intronic
1029650324 7:101886932-101886954 CATCCTGTGGCTGAGGTCTGGGG - Intronic
1030427728 7:109400692-109400714 GAAATTGAGGCAGAGGTCAGAGG + Intergenic
1031875155 7:127131135-127131157 GAGCCTGTTTCAGAGGTCAGTGG - Intronic
1034317205 7:150143745-150143767 GAACCTGAGGCAGAGGGCAGCGG + Intergenic
1034775546 7:153823472-153823494 GAACCTGAGGCAGAGGGCAGCGG - Intergenic
1035042618 7:155941318-155941340 GATGCTGTTACAGAGCTCAGGGG - Intergenic
1035626332 8:1073826-1073848 TATTCTGTGGCAGAGTCCAGGGG + Intergenic
1036026154 8:4911408-4911430 TATGCTGTGTCAGAGGTCAAGGG - Intronic
1037594147 8:20340529-20340551 CATACTGGGGCAGATGTCAGAGG - Intergenic
1041134114 8:54737553-54737575 GTTTCAGTGGCAGAACTCAGAGG - Intergenic
1042877469 8:73452263-73452285 GGCTCTGTGACAGAGGACAGAGG + Intronic
1044742069 8:95337525-95337547 GTTCCTGTGGCAGAGCTCTGGGG + Intergenic
1046590101 8:116195895-116195917 GACTCTGTGGCTGAGGTGGGAGG - Intergenic
1046789937 8:118310502-118310524 TTTTCTGTGGCAGAGCTCTGAGG + Intronic
1046912860 8:119647715-119647737 GATTCTGTGGCCGGGCGCAGTGG + Intronic
1048599322 8:135902294-135902316 GATTGTGGGGCAGAGGTCCTAGG - Intergenic
1048888686 8:138929571-138929593 GATGCTGGCGCAGAGGTCTGGGG + Intergenic
1052070223 9:24072975-24072997 GTTCCTGTGCCAAAGGTCAGGGG - Intergenic
1053002450 9:34584784-34584806 GATTCTGTGGCAGAGGTCAGAGG - Intronic
1053298134 9:36929713-36929735 GATTCTGTGGCAGCAGGCAGAGG - Intronic
1055407633 9:75991280-75991302 GATTCTGTGCCAGGGGTGGGAGG - Intronic
1059750924 9:117246635-117246657 AATTCTGGGGAAGAGGACAGAGG + Intronic
1060483696 9:124033634-124033656 GCTTGTGATGCAGAGGTCAGAGG + Intergenic
1060929293 9:127478803-127478825 CATTCTGAGGCAGTGGTCTGGGG + Intronic
1060956669 9:127646341-127646363 GACACGGTGGCAGAGGTGAGGGG - Intronic
1185811214 X:3112335-3112357 GGCTCTGTGGCAGGTGTCAGGGG - Exonic
1186564809 X:10651198-10651220 GAATATGTGGAAGAGCTCAGAGG + Intronic
1187201863 X:17142014-17142036 GATGCTGATGCACAGGTCAGTGG + Intronic
1187463429 X:19507739-19507761 GAGTTTGTGGGAGAGGGCAGAGG + Intronic
1188290096 X:28377006-28377028 GATTCTGATTTAGAGGTCAGAGG - Intergenic
1192468657 X:71377224-71377246 CATTATTTGGAAGAGGTCAGTGG - Intronic
1193436343 X:81478761-81478783 TATTCTGTGGAAAAGGTAAGTGG + Intergenic
1195573450 X:106422720-106422742 GAGACTGTAGTAGAGGTCAGAGG + Intergenic
1195827731 X:109020843-109020865 AATTCTGTGAAAAAGGTCAGTGG + Intergenic
1196813903 X:119649947-119649969 GAGTCGGTGGCAGAGATCAATGG - Exonic
1200006267 X:153086952-153086974 GATTCAGAGGCAGGGGACAGGGG - Intergenic