ID: 1053002452

View in Genome Browser
Species Human (GRCh38)
Location 9:34584791-34584813
Sequence TCACACCGATTCTGTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002452_1053002460 18 Left 1053002452 9:34584791-34584813 CCTCTGCCACAGAATCGGTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002452_1053002461 22 Left 1053002452 9:34584791-34584813 CCTCTGCCACAGAATCGGTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002452_1053002454 1 Left 1053002452 9:34584791-34584813 CCTCTGCCACAGAATCGGTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1053002454 9:34584815-34584837 TGCTCTGCCCCAGCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002452 Original CRISPR TCACACCGATTCTGTGGCAG AGG (reversed) Intronic
900437089 1:2635879-2635901 TGACACAGATTTTGGGGCAGCGG - Intergenic
900989006 1:6089346-6089368 TTGCACAGATACTGTGGCAGAGG - Intronic
901825851 1:11860401-11860423 TGACACCAATTCTCTGGAAGGGG - Intergenic
902446386 1:16467681-16467703 ACACACAGATTCTGTGGCATAGG + Intergenic
907714152 1:56912235-56912257 TCACAGCCATTCTGTGACATAGG - Intronic
909436642 1:75649802-75649824 TCTCACCTATTCTGGAGCAGAGG + Intergenic
909476624 1:76088175-76088197 ACAAAACTATTCTGTGGCAGTGG + Intronic
910035191 1:82780146-82780168 TCACACTGATTCTGGCCCAGGGG - Intergenic
912986672 1:114440135-114440157 TAACAATGATTCTGTGGAAGAGG + Intronic
913998716 1:143674167-143674189 TCACAGATATTCTGTGGCATAGG - Intergenic
915495319 1:156278402-156278424 TCTCACTCACTCTGTGGCAGTGG + Intronic
920501553 1:206488480-206488502 TCACAAGGATGCTGTGGCAGGGG + Intronic
1065517685 10:26541116-26541138 TCACTCCGTTTCTGGGTCAGTGG + Intronic
1073033900 10:100549618-100549640 TCACATCTATTCAGTGGGAGTGG + Exonic
1075806461 10:125192525-125192547 ACACACCGAATTTGTGTCAGTGG - Intergenic
1081312899 11:41594611-41594633 TCACACAGCTTCTGTGGCTCAGG - Intergenic
1085067467 11:73510436-73510458 TCCCACATATTCTGTGGCAGAGG - Intronic
1085131344 11:74041659-74041681 TCACAGCGATTCTCTGGCTCAGG + Intronic
1086607256 11:88710527-88710549 TAACACATATTCTGTGGGAGTGG - Intronic
1086793826 11:91075047-91075069 TCTCACTGATACTGTAGCAGAGG - Intergenic
1090579803 11:128147592-128147614 TGTCAAGGATTCTGTGGCAGTGG + Intergenic
1103855060 12:123961862-123961884 TCACACCTAGTAAGTGGCAGAGG + Intronic
1104144472 12:126019254-126019276 TCACACAGATTCTGTGCCCCAGG - Intergenic
1105793189 13:23823312-23823334 TCATACTAATTTTGTGGCAGAGG - Intronic
1106880616 13:34125622-34125644 TCAAACCAATTCTTTGACAGTGG + Intergenic
1109855297 13:68119262-68119284 ACACACTGATTTTGTGGCAAAGG - Intergenic
1110565513 13:76953880-76953902 TCAAACAGATTGTGTAGCAGAGG + Intronic
1122302257 14:100737859-100737881 TGACACTGCTTCTGTGGCACGGG - Exonic
1125920395 15:43522037-43522059 CCACACCCATTTTGTGGAAGAGG - Exonic
1127851111 15:62912623-62912645 TCACAGCTCTTCTGTGGCAGAGG - Intergenic
1135167993 16:20157372-20157394 TCACAGGAATTCTCTGGCAGGGG - Intergenic
1137480321 16:48847103-48847125 TCCCACCGTTTCTGTGGGTGAGG - Intergenic
1139427212 16:66889414-66889436 TCCCAGCTACTCTGTGGCAGAGG - Exonic
1142205880 16:88782941-88782963 CCACACTGATTCTGTGTCTGGGG - Intronic
1144358200 17:14466209-14466231 TCACACAGTTTCTGTGGGTGAGG + Intergenic
1148688313 17:49512987-49513009 TCACACCGGGGATGTGGCAGTGG - Exonic
1148859028 17:50594482-50594504 TCTCACCGGTTCGGAGGCAGTGG - Intronic
1149178685 17:53906622-53906644 TCTCACCAATTCAGAGGCAGAGG - Intergenic
1154956275 18:21258674-21258696 TCAAAACAATTCTGTGGCAGAGG + Intronic
1163049707 19:14673209-14673231 TCACAGCTATTCTGCTGCAGAGG - Intronic
926424868 2:12731505-12731527 TCAAACTGAGACTGTGGCAGTGG + Intronic
930257268 2:49106653-49106675 TGACACCGAATCTGTGTCACTGG + Intronic
930647917 2:53931313-53931335 CCACGCCTATTCTGTGACAGTGG + Intronic
934125589 2:88886043-88886065 CCTGACCGATTCAGTGGCAGCGG + Intergenic
934126466 2:88897674-88897696 CCACCTCGATTCAGTGGCAGCGG + Intergenic
934153876 2:89176416-89176438 CCAGACAGATTCAGTGGCAGTGG - Intergenic
934213359 2:90005519-90005541 CCAGACAGATTCAGTGGCAGTGG + Intergenic
935496572 2:103789450-103789472 TAACAATGATTCTGTGGCATGGG + Intergenic
936682051 2:114785200-114785222 TCACACTGTTTATTTGGCAGAGG + Intronic
941589951 2:167407021-167407043 TAACATGTATTCTGTGGCAGTGG - Intergenic
943343497 2:186709558-186709580 TCCCACTGTTTTTGTGGCAGGGG - Intronic
944364816 2:198905700-198905722 TGAGACCCATTATGTGGCAGAGG + Intergenic
944930068 2:204508312-204508334 TCACACAGTTTCTGTGGGTGAGG + Intergenic
948414150 2:237789553-237789575 TCACACAGATTCTGTGGATCAGG + Intronic
1168854831 20:1001373-1001395 TCACAGCGAGGCTGTGGCATAGG + Intronic
1171896784 20:30815662-30815684 TCACACGAAGTCTGTGGCATTGG + Intergenic
1174269297 20:49355423-49355445 TCACACAGTTTCTGTGGCTCAGG - Intergenic
1174609906 20:51790492-51790514 TCACAGGGATTCTCTGGCAGGGG + Exonic
1177422883 21:20884521-20884543 TCACACAGATTTTGTGGTTGGGG + Intergenic
1179188527 21:39104006-39104028 TAATACCTATCCTGTGGCAGAGG + Intergenic
1180053417 21:45344343-45344365 TCAGACAGAGCCTGTGGCAGAGG + Intergenic
1180240482 21:46500492-46500514 TAACTCCAATTCTGAGGCAGGGG + Intronic
1183859400 22:40658582-40658604 TCACACCTCTTTTGTGGTAGTGG + Intergenic
1184294969 22:43517353-43517375 TCACACAGTTACTGTGGCACTGG - Intergenic
951507176 3:23460186-23460208 TAACTCCAATTCTGTGCCAGAGG - Intronic
952860209 3:37806680-37806702 TCCCTCCCAGTCTGTGGCAGAGG - Intronic
956452103 3:69385418-69385440 TCACACCAATTTGCTGGCAGAGG - Intronic
961436913 3:126925597-126925619 GAACACTGATGCTGTGGCAGAGG - Intronic
962223826 3:133587470-133587492 TCACATCGATTTTGTGGGAGTGG - Intronic
963907435 3:150784191-150784213 TCCCACAGATGGTGTGGCAGTGG - Intergenic
964686656 3:159403427-159403449 TCACACCAATCCTTTGGCAGTGG + Intronic
970052426 4:11929704-11929726 TCACCCCTATTCTTTGGCTGAGG - Intergenic
978450978 4:108833271-108833293 TCTTACAGATTCTGCGGCAGTGG + Intronic
985488409 5:164834-164856 TCACACTAATGCTGTGACAGGGG + Intronic
992271517 5:75069104-75069126 ACACACCAAGTTTGTGGCAGAGG - Intronic
998753483 5:145351188-145351210 TCACTCAGATTCTCTGGGAGGGG + Intergenic
1001511642 5:172327268-172327290 TCACAACGATTCTGTGAGAAAGG + Intronic
1001592398 5:172874402-172874424 TCCCACAGATTCTGAGGCAGTGG + Intronic
1001934195 5:175693053-175693075 ACACAGCCAATCTGTGGCAGGGG - Intergenic
1002344434 5:178537519-178537541 TCAGAGGGAGTCTGTGGCAGGGG + Intronic
1004286269 6:14323550-14323572 TCACTTTGATTCTGTGTCAGCGG + Intergenic
1005153192 6:22775952-22775974 ACACTCCCATTCTGTGGCAATGG - Intergenic
1006918675 6:37613458-37613480 TGTCATCAATTCTGTGGCAGAGG - Intergenic
1007257740 6:40540619-40540641 TCTCAACGATACTGCGGCAGAGG - Intronic
1007759383 6:44124273-44124295 TCACACCAAGTCTGTGGCCCTGG + Intronic
1007946979 6:45835716-45835738 CCCCACCTTTTCTGTGGCAGGGG + Intergenic
1018721176 6:166573619-166573641 TCACACTGACTCTGTGGCTCCGG + Intronic
1022969320 7:35503062-35503084 TCCCAGCGGCTCTGTGGCAGAGG + Intergenic
1028612518 7:92727630-92727652 TCACACCGACCTTGTAGCAGTGG - Intronic
1030219536 7:107083010-107083032 TAACAGAGATTCTGAGGCAGAGG + Intronic
1031693022 7:124814176-124814198 TCACCCTGAGTCTGTGTCAGGGG + Intergenic
1032418814 7:131761218-131761240 TCACACCCATTCAGAGGAAGGGG - Intergenic
1037451006 8:19014964-19014986 TCACACTGCTGCTCTGGCAGGGG - Intronic
1038382840 8:27112999-27113021 TCACAGCAATCCTGTGGAAGTGG + Intergenic
1043997893 8:86842330-86842352 TCGCTCCCATTCTGTGGCAGTGG + Intergenic
1045740892 8:105358573-105358595 ACACAGAGATTCTGTGTCAGTGG - Intronic
1049410834 8:142473324-142473346 CCACCCCGATTCTGAGGCAAAGG - Intronic
1053002452 9:34584791-34584813 TCACACCGATTCTGTGGCAGAGG - Intronic
1056116449 9:83446068-83446090 ACACAACTATTCAGTGGCAGAGG + Intronic
1056891456 9:90497564-90497586 TCACAACCATTTTGTGGCACTGG + Intergenic
1059691519 9:116689328-116689350 TCACAACAATTCTGTGACATTGG - Intronic
1197034222 X:121854557-121854579 GCACACACAGTCTGTGGCAGGGG + Intergenic
1198262362 X:134976250-134976272 ACATACTGATTATGTGGCAGTGG + Intergenic