ID: 1053002453

View in Genome Browser
Species Human (GRCh38)
Location 9:34584797-34584819
Sequence GAGCAATCACACCGATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002453_1053002454 -5 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1053002454 9:34584815-34584837 TGCTCTGCCCCAGCCTCCTCTGG No data
1053002453_1053002460 12 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002453_1053002461 16 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002453 Original CRISPR GAGCAATCACACCGATTCTG TGG (reversed) Intronic
912705526 1:111909169-111909191 ATGCAATCACACCTATTGTGGGG - Intronic
912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG + Intergenic
913216953 1:116628663-116628685 GAGCACTGACACTGCTTCTGGGG + Intronic
922723727 1:227912656-227912678 GAGCACTCACATTGATTCTGTGG + Intergenic
1062786993 10:273033-273055 AAGCAGTCACACTGCTTCTGTGG - Intergenic
1064632326 10:17329053-17329075 CAGCAGTCACAATGATTCTGGGG - Intronic
1072937467 10:99727083-99727105 GAGTACTCACACCGAATGTGGGG - Exonic
1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG + Intronic
1075907103 10:126091060-126091082 GAGCCATCACACGGAAACTGTGG + Intronic
1085126995 11:74008631-74008653 GAGGAATCGCAGAGATTCTGGGG + Intronic
1090497343 11:127226580-127226602 GAGCAATCACTCCACTTCTCTGG - Intergenic
1102529995 12:113539280-113539302 TAGCAATCACACCTCTTCTCTGG - Intergenic
1106122518 13:26872478-26872500 GAGCAATCAAACCCCTGCTGTGG - Intergenic
1109244220 13:59933273-59933295 GAGCAATCACAGCCATAATGAGG - Intronic
1110137159 13:72082128-72082150 GAGGAATGACACAGATTCTGGGG - Intergenic
1111707872 13:91774170-91774192 GAGAAATCACACCTGTTCAGAGG + Intronic
1125589873 15:40847429-40847451 GAACAAACAAACCCATTCTGGGG - Intronic
1134322686 16:13178067-13178089 GAATAATCACATCGATTTTGAGG + Intronic
1137038883 16:35591703-35591725 GAGAAATCCCACCGACCCTGTGG + Intergenic
1138601200 16:58055683-58055705 GAGCAAGCACAAAGATCCTGAGG + Intergenic
1145229764 17:21165082-21165104 GAGCGATCATCCCCATTCTGAGG + Intronic
1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG + Intronic
925909911 2:8566943-8566965 GAGCCATCTCACCTATTGTGCGG + Intergenic
933785775 2:85840365-85840387 CGGCAATGACACCGATTGTGGGG + Exonic
936084649 2:109458726-109458748 GAGCAATCACAGGCATCCTGTGG - Intronic
936088472 2:109485992-109486014 GAGCGCACACACTGATTCTGTGG - Intronic
939382272 2:141450993-141451015 ATGCAATCACACAGATTGTGAGG - Intronic
939519235 2:143208608-143208630 AAGCAACCACACCGATTCTCAGG - Intronic
944131341 2:196350550-196350572 GAGCAATCACAGCAATGCTGTGG + Intronic
1171340522 20:24423511-24423533 GAGCAGTCACAGCGCTCCTGAGG - Intergenic
1181328266 22:22068306-22068328 GTGCAATCCCACAGTTTCTGTGG - Intergenic
1185234197 22:49702267-49702289 GGGCCATCACACCCATTCTGGGG - Intergenic
955512224 3:59692746-59692768 AAGCAATCACACCGATTCATGGG - Intergenic
959595085 3:108120991-108121013 GAGCATTCACAGTGATTCTTAGG - Intergenic
964901221 3:161660897-161660919 GAGCTTTCACACCTACTCTGGGG - Intergenic
978231911 4:106410038-106410060 GAGCCACCACACCAATTCTTTGG + Intergenic
978499772 4:109396765-109396787 GAGAAATCTCACCATTTCTGTGG - Intergenic
982538633 4:156639495-156639517 CAGCAATCACAAAGATTCTGAGG + Intronic
985007894 4:185552581-185552603 GAGTAAACACACAGATTCAGAGG - Intergenic
987101915 5:14598365-14598387 GAGAAATCACACCAGTACTGGGG + Intronic
990825222 5:59892213-59892235 GACCAATTACAGCCATTCTGAGG - Intronic
992032288 5:72733764-72733786 GAGCACTCCCACCTATTCTTGGG + Intergenic
994789028 5:104200485-104200507 GAGAAAACACATCGATTTTGAGG + Intergenic
1000977788 5:167783776-167783798 GAGGAATCACACAGATGGTGTGG + Intronic
1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG + Intronic
1007739577 6:44002498-44002520 GAGCCCTGACATCGATTCTGCGG - Intronic
1015425248 6:133057512-133057534 GAACAATCACACAGATCCTCTGG - Intergenic
1019503992 7:1381399-1381421 GTGCCATCACACCGCCTCTGCGG - Intergenic
1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG + Intronic
1050993837 9:12188090-12188112 GAGTAATCACACCTATCTTGTGG - Intergenic
1052044653 9:23779954-23779976 GAACACTATCACCGATTCTGGGG - Intronic
1053002453 9:34584797-34584819 GAGCAATCACACCGATTCTGTGG - Intronic
1056691995 9:88815715-88815737 GAGCAGACACTCCGCTTCTGGGG - Intergenic
1058832935 9:108835532-108835554 CATGAATCACACTGATTCTGTGG + Intergenic
1186532310 X:10309808-10309830 AAGCAATCTCACCCATTATGGGG - Intergenic
1191599800 X:62990654-62990676 GAGAAGTCACACAGATTCTCAGG - Intergenic
1197237783 X:124087710-124087732 AAGCAATCACAGAGATTCTAGGG + Intronic
1200116318 X:153771214-153771236 GAACAATCACATTCATTCTGGGG + Intronic