ID: 1053002453 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:34584797-34584819 |
Sequence | GAGCAATCACACCGATTCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053002453_1053002460 | 12 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
Right | 1053002460 | 9:34584832-34584854 | CTCTGGTCCAGACCTTTCCAAGG | No data | ||||
1053002453_1053002461 | 16 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
Right | 1053002461 | 9:34584836-34584858 | GGTCCAGACCTTTCCAAGGAAGG | No data | ||||
1053002453_1053002454 | -5 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
Right | 1053002454 | 9:34584815-34584837 | TGCTCTGCCCCAGCCTCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053002453 | Original CRISPR | GAGCAATCACACCGATTCTG TGG (reversed) | Intronic | ||