ID: 1053002453 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:34584797-34584819 |
| Sequence | GAGCAATCACACCGATTCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053002453_1053002454 | -5 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
| Right | 1053002454 | 9:34584815-34584837 | TGCTCTGCCCCAGCCTCCTCTGG | No data | ||||
| 1053002453_1053002460 | 12 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
| Right | 1053002460 | 9:34584832-34584854 | CTCTGGTCCAGACCTTTCCAAGG | No data | ||||
| 1053002453_1053002461 | 16 | Left | 1053002453 | 9:34584797-34584819 | CCACAGAATCGGTGTGATTGCTC | No data | ||
| Right | 1053002461 | 9:34584836-34584858 | GGTCCAGACCTTTCCAAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053002453 | Original CRISPR | GAGCAATCACACCGATTCTG TGG (reversed) | Intronic | ||