ID: 1053002453

View in Genome Browser
Species Human (GRCh38)
Location 9:34584797-34584819
Sequence GAGCAATCACACCGATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002453_1053002460 12 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC No data
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002453_1053002461 16 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC No data
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002453_1053002454 -5 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC No data
Right 1053002454 9:34584815-34584837 TGCTCTGCCCCAGCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002453 Original CRISPR GAGCAATCACACCGATTCTG TGG (reversed) Intronic