ID: 1053002455

View in Genome Browser
Species Human (GRCh38)
Location 9:34584822-34584844
Sequence GTCTGGACCAGAGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 404}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002455_1053002467 25 Left 1053002455 9:34584822-34584844 CCCCAGCCTCCTCTGGTCCAGAC 0: 1
1: 0
2: 2
3: 45
4: 404
Right 1053002467 9:34584870-34584892 TGCACTCCTTCCCTGAGTGAAGG No data
1053002455_1053002461 -9 Left 1053002455 9:34584822-34584844 CCCCAGCCTCCTCTGGTCCAGAC 0: 1
1: 0
2: 2
3: 45
4: 404
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002455 Original CRISPR GTCTGGACCAGAGGAGGCTG GGG (reversed) Intronic
900089458 1:913528-913550 GGGTGGACCAGAGCAGGCAGGGG - Intergenic
900339050 1:2179187-2179209 GCCTGGACCGGCGGAGGGTGGGG - Intronic
900356974 1:2269753-2269775 CTCTGGACCAGAGCAGTGTGTGG + Intronic
900498309 1:2986989-2987011 CCCTGGACCAGACCAGGCTGGGG + Intergenic
900583828 1:3422954-3422976 ATCAGGAGCAGAGAAGGCTGAGG + Intronic
900658675 1:3772488-3772510 GCCTGGTCCAGAAGGGGCTGGGG - Intergenic
900870527 1:5299026-5299048 GGCTGTACCACATGAGGCTGGGG + Intergenic
900954036 1:5875835-5875857 GTCTAACACAGAGGAGGCTGAGG + Intronic
901447971 1:9319646-9319668 GGCTGGTGCAGAGGATGCTGCGG + Intronic
901906892 1:12420317-12420339 GTGTAGACCAGAGGAGTTTGAGG + Intronic
902683248 1:18058650-18058672 GTATGAGCCAGAGGAGGCTGAGG - Intergenic
903088011 1:20881702-20881724 GCCTGAGCCAGGGGAGGCTGAGG + Intronic
903177293 1:21588774-21588796 CTGGGGAGCAGAGGAGGCTGGGG + Intergenic
903320725 1:22541638-22541660 GCCTGGCCCAGAGGAGGGCGGGG - Intergenic
904563144 1:31412208-31412230 ATCTTGTCCAGAGGTGGCTGAGG + Intronic
905164264 1:36067740-36067762 GTCTGGAACCCAGGAGGCGGAGG + Exonic
905414504 1:37794793-37794815 GACAGGACCAGAGGGAGCTGGGG - Intronic
905851338 1:41277365-41277387 CCCTGGAGCAGAGGGGGCTGTGG + Intergenic
906288571 1:44604342-44604364 GGCTGGGCCAGTGGAGGGTGGGG - Intronic
906518292 1:46452476-46452498 CTCTGGACCATGGGAGGCAGGGG - Intergenic
907056394 1:51372740-51372762 AACTGGAGCAGAGGAAGCTGAGG + Intronic
907276011 1:53317000-53317022 TTCTGGACCCGTGGAGGCTATGG - Intronic
907519870 1:55016052-55016074 GACTGGACCAGGGCGGGCTGTGG + Intergenic
909222733 1:72983827-72983849 GGGTGGAGCAGTGGAGGCTGAGG + Intergenic
910092478 1:83481366-83481388 GGCTGGAGCAGAGTAGGATGAGG - Intergenic
910238826 1:85064235-85064257 ACCTGAACCAGAGGAGGCTGTGG + Intronic
911195150 1:94987045-94987067 TTCTGGAACTGAGGAGGATGTGG + Intronic
912491330 1:110064391-110064413 ATTTGGACCAGAAGAGCCTGTGG + Intronic
912701020 1:111878399-111878421 CCCTGGACAGGAGGAGGCTGGGG - Intronic
912716937 1:111989775-111989797 GGCTGGAGCGGCGGAGGCTGCGG - Intergenic
913164854 1:116175601-116175623 GTTTGGACCAGAGGCAGCGGTGG + Intergenic
915276021 1:154788703-154788725 GGCTGGCTCACAGGAGGCTGTGG - Intronic
915361846 1:155290545-155290567 GGCTGGGCCAGAGGAGGGAGGGG + Exonic
915558370 1:156672843-156672865 GCCTGGACCAGAGGAGCCTGGGG - Exonic
916031929 1:160884589-160884611 GTGTGGCCCTGAGGGGGCTGTGG - Intronic
916957873 1:169859113-169859135 GCTTGGACCAGAGGTGGTTGTGG - Exonic
918508243 1:185281369-185281391 AACTGGAGCAGAGGAAGCTGAGG + Intronic
919724253 1:200872006-200872028 GTCTGACCCTGAGGAGGCAGTGG - Intergenic
920331585 1:205211834-205211856 GGCTGGAGAAGGGGAGGCTGTGG + Intergenic
920914253 1:210247139-210247161 GTGCTGACCAGAGGAGGCAGTGG - Intergenic
920921775 1:210303434-210303456 GCCTGCACCTGTGGAGGCTGAGG - Intergenic
922237906 1:223735580-223735602 GGCTGGACCAGAGGTGGTTGGGG - Intronic
922696629 1:227734162-227734184 GTCTGGCTCAGAGGAGGGTCTGG - Intronic
923391037 1:233514988-233515010 GTCTAGAGCAGTGGAGGCTCCGG - Intergenic
1063454284 10:6172306-6172328 TTTTGGAGCAGAGGAGGCAGAGG + Intronic
1064375059 10:14787994-14788016 ATCAGGATCAGAGGATGCTGGGG - Intergenic
1064422766 10:15204728-15204750 GCCTGAACCAGAATAGGCTGAGG - Intergenic
1065662567 10:28021180-28021202 CTCTGGCCCAGAGGAGGTTGTGG - Intergenic
1066125615 10:32338852-32338874 GCCTGGAGCCCAGGAGGCTGAGG + Intronic
1067042429 10:42962170-42962192 GCCTGGAGCACAGGAGGCCGGGG - Intergenic
1068083299 10:52346626-52346648 GTCTGAAGCAGTGGAGGCTCTGG - Intergenic
1069909082 10:71748988-71749010 GGCCGCACCAGAGGAAGCTGAGG + Exonic
1070312042 10:75281002-75281024 AGCTGGAGGAGAGGAGGCTGGGG + Intergenic
1070799552 10:79237183-79237205 GGCTGGACCAGAGTAAGCCGAGG + Intronic
1070918311 10:80168934-80168956 GCCTGGACCAAGGGAGGCAGTGG + Intronic
1071364024 10:84880590-84880612 GGCTGGAGAAGAGGAGGATGGGG - Intergenic
1071499778 10:86195086-86195108 GTCTGGCCCAGAGGAAGCTTAGG + Intronic
1072630869 10:97145632-97145654 GGCTGGACCCGAGAAGACTGAGG + Intronic
1072750687 10:97976110-97976132 GTCTGGATGAGAGTACGCTGCGG - Intronic
1073282687 10:102366273-102366295 TACTGGAAGAGAGGAGGCTGAGG - Intronic
1073468132 10:103706299-103706321 GGCTGGACTGGAGGAGCCTGAGG + Intronic
1074079538 10:110156800-110156822 GTCTGGACCAGAGTCCCCTGGGG + Intergenic
1074248143 10:111714570-111714592 GTCTGGAGCAGCAGAGGCTCAGG + Intergenic
1075395299 10:122122653-122122675 GTCAGGCCCAGAGCATGCTGTGG + Intronic
1076474479 10:130742850-130742872 GTCAGGCCCAGAGGAGGCAGAGG - Intergenic
1076640006 10:131909006-131909028 GGCTGGACCAGAGCACACTGAGG + Intronic
1076659264 10:132044488-132044510 GGCTGGTGCAGAGGAGGGTGCGG + Intergenic
1076811797 10:132890225-132890247 GGCTCGGGCAGAGGAGGCTGTGG - Intronic
1077185840 11:1234969-1234991 GGCTGGGCCTGGGGAGGCTGAGG + Intronic
1077188667 11:1246674-1246696 CTCTGGAGTAGAGGAGGGTGTGG - Exonic
1077305889 11:1868553-1868575 GGCTGGCCCTGAGGGGGCTGGGG + Intronic
1077327062 11:1968503-1968525 GCCTGGACCTGAGACGGCTGGGG + Intronic
1077339387 11:2019217-2019239 GGCTGCACCTGGGGAGGCTGGGG + Intergenic
1077364563 11:2156328-2156350 GACTGGACCTGAGCAGGCCGGGG + Intronic
1077614070 11:3662442-3662464 GAGTGGATCAGAGGAAGCTGGGG - Intronic
1078275640 11:9842867-9842889 GTCTGGACCAGTAGTGGCTGTGG - Intronic
1079937738 11:26638490-26638512 GTTCAGACCAGAGGAGACTGGGG + Intronic
1080411692 11:32030883-32030905 TTCTGGACTAGCTGAGGCTGAGG + Intronic
1080655187 11:34252804-34252826 AGCTGGGCCAGAGGAGGCTGGGG + Intronic
1080775663 11:35384046-35384068 GGCTGGAACAGAGGAGGCGATGG - Intronic
1081703735 11:45168293-45168315 GTCTGGACCACAGGACCCAGAGG - Intronic
1081740170 11:45433689-45433711 GGCTTGAGCAGAGGAGGTTGAGG + Intergenic
1082006385 11:47421528-47421550 GTCCAGAGCAGGGGAGGCTGGGG + Intronic
1082785306 11:57313356-57313378 GTCAGGACCAGGAGAAGCTGGGG - Exonic
1083120300 11:60505696-60505718 GTCTGTAGCTGAGAAGGCTGGGG + Intronic
1083300455 11:61737360-61737382 GTTGGGACCAGTGGAGGCTGAGG + Intronic
1083490876 11:63014542-63014564 GTGGGCAGCAGAGGAGGCTGGGG - Intronic
1084183004 11:67455879-67455901 GTCTGGGGCAGAAGAGGCAGAGG - Intronic
1084353974 11:68624568-68624590 GGGTGGAGGAGAGGAGGCTGAGG - Intergenic
1084371523 11:68748073-68748095 GCCTGGACCAGAGGACAGTGGGG + Intronic
1084537297 11:69764643-69764665 GTGTGGACCCACGGAGGCTGAGG + Intergenic
1084972175 11:72777913-72777935 GACAGGCCCAGAGCAGGCTGAGG + Intronic
1085048644 11:73368074-73368096 GTCTGGACCCCACGGGGCTGGGG + Exonic
1085472418 11:76766774-76766796 GGCTGGCTCTGAGGAGGCTGTGG + Intergenic
1086002710 11:82000899-82000921 GTCTGGACCACTGGAGCCAGTGG + Intergenic
1087053526 11:93909448-93909470 ATCTGAACCTGGGGAGGCTGAGG - Intergenic
1087406745 11:97740567-97740589 GTGTGGATCAGTGGAGGTTGTGG - Intergenic
1088596038 11:111440980-111441002 GTCTGGGCCAGATGGGTCTGCGG - Intronic
1089183537 11:116599133-116599155 CTTTGGACCAGAGTAGTCTGAGG - Intergenic
1089489644 11:118874200-118874222 GACTGGAGCAGAGGAAGATGTGG - Intergenic
1089527346 11:119106152-119106174 GTCTGAGCCAGAGGAGGTGGTGG - Intronic
1089841938 11:121426109-121426131 GGCTGGAGCAAAGGAAGCTGGGG - Intergenic
1090164892 11:124536370-124536392 TTCTGAAACAGAGGAGGGTGGGG - Intergenic
1090759002 11:129819346-129819368 GTCTGGAGGTGAGAAGGCTGGGG + Intronic
1091304793 11:134530363-134530385 GTGGGGAACAGAGGAGGGTGGGG - Intergenic
1202810044 11_KI270721v1_random:23683-23705 GCCTGGACCTGAGACGGCTGGGG + Intergenic
1202822372 11_KI270721v1_random:74406-74428 GGCTGCACCTGGGGAGGCTGGGG + Intergenic
1092075043 12:5665807-5665829 GGCTGGATCAGCTGAGGCTGTGG - Intronic
1092163672 12:6329740-6329762 GGCTGGAGACGAGGAGGCTGGGG - Intronic
1093534550 12:20208161-20208183 GTCTGGAGCCCAGGAGGCAGAGG + Intergenic
1094289666 12:28833094-28833116 GTTTGCACCAGAGGTGGCAGAGG - Intergenic
1095319220 12:40805754-40805776 GTATGGAACAGTAGAGGCTGAGG + Intronic
1098227978 12:68344478-68344500 GGCTGGAGCAGAGGAAGCTTTGG + Intergenic
1100312990 12:93414568-93414590 GTCTGGAACAGAGAAGGTTAGGG - Intronic
1101772120 12:107761108-107761130 GTGCGGCCCAGAGGAGGCCGCGG - Exonic
1102983758 12:117262670-117262692 TTCTGGACCTGAGGGAGCTGAGG + Intronic
1103556296 12:121768692-121768714 GTTTGGACTAGAGGAGCCTGGGG + Intronic
1103833862 12:123803306-123803328 CTCCAGGCCAGAGGAGGCTGCGG + Intronic
1103937757 12:124485612-124485634 GTCTGGAGGAGGGGAGGCCGAGG - Intronic
1103975762 12:124701540-124701562 ATCTGGAACAGTAGAGGCTGGGG - Intergenic
1104047722 12:125174752-125174774 CTCTGGTCAAGAGAAGGCTGAGG - Intergenic
1104805256 12:131585895-131585917 GTCTGGAGCAGTGGAGGCGCTGG - Intergenic
1105482495 13:20791985-20792007 TTCTGCTCCAGAGCAGGCTGGGG - Intronic
1105829352 13:24150210-24150232 GTTTGGAGAAGTGGAGGCTGTGG - Intronic
1106389498 13:29321203-29321225 GACTGGACAGGAGAAGGCTGAGG + Intronic
1107429803 13:40330177-40330199 GCTTGGACCAGTGGAGTCTGTGG - Intergenic
1108272420 13:48774637-48774659 GCTTGGACCAGAGGAGGAGGAGG - Intergenic
1113546222 13:111153448-111153470 GACTGGACAGGAGGAGGCGGCGG + Intronic
1113586253 13:111468126-111468148 GTCTGGACCAGGGGTGGCATGGG + Intergenic
1113768626 13:112895198-112895220 GGCTGGGCCAGAGGGGGCTCTGG + Intronic
1113825423 13:113249053-113249075 GTCCGGAGCAGAGCAGGCTGGGG - Intronic
1114317776 14:21523835-21523857 GTTAGGTCCAGAAGAGGCTGAGG + Exonic
1114524910 14:23361480-23361502 GTTTCTACCAGAAGAGGCTGAGG + Intronic
1116868098 14:50047625-50047647 GGCTGGACCAGAAGTTGCTGAGG + Intergenic
1116972612 14:51082146-51082168 GTCTTGACCAGAGGTGACTCAGG - Intronic
1118087865 14:62440246-62440268 GTCTGGACTTCAGGAGACTGTGG + Intergenic
1120650767 14:87130117-87130139 GTCTGCACTTTAGGAGGCTGAGG - Intergenic
1121328074 14:93033441-93033463 GGCTGGCCCAGAGGAGGTGGTGG - Intronic
1121412379 14:93756888-93756910 GACTGGCCCAGAGGCTGCTGTGG - Intronic
1121491081 14:94361643-94361665 GTCAGCTCCAGAGGAGGCTGAGG + Intergenic
1121492476 14:94370124-94370146 GTCAGCTCCAGAGGAGGCTGAGG + Intergenic
1122871536 14:104641081-104641103 GTCAGGAGCAGAGGGTGCTGGGG + Intergenic
1126310094 15:47305856-47305878 GCCTGGATCAAAGGAGGCTCTGG - Intronic
1127629582 15:60814604-60814626 GGCTGCACCAGTGGATGCTGAGG + Intronic
1127772467 15:62242906-62242928 GCCTGAACAAGAAGAGGCTGGGG - Intergenic
1128222270 15:65977731-65977753 GACTGGAAGAGAGGAGGCTGAGG - Intronic
1129385240 15:75192627-75192649 TGCTGGAGCAGAGGGGGCTGTGG + Intergenic
1129405335 15:75313235-75313257 GGCTGGAGCAGAGGACGGTGTGG + Intergenic
1130564417 15:84981677-84981699 GTCTGGAGCCGGGGAGGCGGCGG + Intronic
1131455254 15:92578613-92578635 GACAGGGGCAGAGGAGGCTGGGG - Intergenic
1131791692 15:95972508-95972530 CTCTGCACCACAGTAGGCTGTGG + Intergenic
1132778726 16:1611380-1611402 GTCTCGGCTACAGGAGGCTGAGG + Intronic
1135195068 16:20387468-20387490 GTCTGGAGCAGAGTGAGCTGGGG + Intronic
1135205235 16:20478345-20478367 GACTGGCCCAGATGAGCCTGGGG - Intronic
1135213669 16:20545467-20545489 GACTGGCCCAGATGAGCCTGGGG + Intronic
1135588390 16:23688657-23688679 TTCTGTCTCAGAGGAGGCTGAGG + Exonic
1136186470 16:28591498-28591520 GCCTAGACCACAGGAGGCTCTGG - Intronic
1136188957 16:28604222-28604244 GCCTAGACCACAGGAGGCTCTGG - Intergenic
1136371178 16:29837024-29837046 GTCTGGAGGAGAGAAGGCAGAGG - Intronic
1136427494 16:30178810-30178832 GTCTTGCCCAAAGGAGGCTGTGG - Intergenic
1137039941 16:35601140-35601162 GGCTGGAACACAGGAGGCAGAGG + Intergenic
1137067513 16:35863759-35863781 GGCTGGACCTGAGGAAGCAGTGG + Intergenic
1137697339 16:50469948-50469970 GTCCGGGCCAGAAGGGGCTGGGG - Intergenic
1137796917 16:51229185-51229207 GTGTGGACCAGAGGATGCCAGGG - Intergenic
1139258857 16:65572684-65572706 GGCTGGCCCAGAGGATTCTGAGG - Intergenic
1141434247 16:83990345-83990367 GACTGGACCCCAGGAGGCCGTGG + Intronic
1141435952 16:83999766-83999788 GACCTGACCAAAGGAGGCTGAGG - Intronic
1141489983 16:84366408-84366430 GCCTGAACCACAGGATGCTGAGG + Intergenic
1141974506 16:87506432-87506454 ACCTGCAGCAGAGGAGGCTGAGG - Intergenic
1142425235 16:89999071-89999093 GTCTGGTATAGAGGAGCCTGGGG + Intergenic
1142582345 17:949829-949851 GCCTGGAGCAGTGGGGGCTGGGG + Intronic
1142758771 17:2030916-2030938 GGATGGTCCAGCGGAGGCTGGGG - Intronic
1142874419 17:2842861-2842883 TTCTGGGGCAGAGGAAGCTGAGG + Intronic
1143021407 17:3918804-3918826 GTCTGTCCCTGAGGACGCTGGGG - Intergenic
1143317896 17:6046594-6046616 GTCTGGCCCAGAGGTGGCTCTGG - Intronic
1143632302 17:8146246-8146268 GTCTGGAGACCAGGAGGCTGGGG + Intronic
1144521733 17:15957224-15957246 GTCTGGAGCAGAGGAGCCACAGG + Intronic
1144806082 17:17968755-17968777 GAATGGAGCAGAGGTGGCTGTGG - Intronic
1145811040 17:27764384-27764406 GTCTGGGCCAGAGAAGGACGTGG - Intronic
1146631116 17:34470040-34470062 GTGTGGTCCAGAGGTAGCTGGGG - Intergenic
1147586180 17:41655130-41655152 GTCAGGGCCTGGGGAGGCTGGGG - Intergenic
1147753965 17:42755905-42755927 TTCTGGAGATGAGGAGGCTGGGG + Intergenic
1147756224 17:42770008-42770030 TGCTGGAACACAGGAGGCTGAGG - Intergenic
1147762959 17:42812603-42812625 CTCGGGAGGAGAGGAGGCTGAGG + Intronic
1148845747 17:50528856-50528878 GTCTGGGCCAGGTGGGGCTGGGG + Intronic
1150432246 17:65127697-65127719 GGATGGACAAGAGGAGGATGTGG + Intergenic
1150492517 17:65584177-65584199 GTCTGGACCCGAGGACTCAGGGG - Intronic
1151699893 17:75737517-75737539 GTCTGGAGAGGAGGAGGCAGGGG - Exonic
1151954801 17:77374825-77374847 GGCTGGGCCTGAGGAGGGTGTGG + Intronic
1152077140 17:78166761-78166783 GTCTGGTGCAGGGTAGGCTGGGG - Intergenic
1153229794 18:2924819-2924841 GCTGGGACCAGAGCAGGCTGTGG - Intronic
1153536746 18:6109952-6109974 ATCTGGACCAGGGCAGGCCGAGG + Intronic
1153770997 18:8416385-8416407 GCCTGGACCACAGGACACTGGGG + Intergenic
1155636304 18:27959929-27959951 GGCTTGACCCCAGGAGGCTGAGG + Intronic
1160070134 18:75621279-75621301 GTCTGGCCCTGAGAAGACTGCGG + Intergenic
1161693938 19:5754735-5754757 GTCTGGGCGTGATGAGGCTGTGG + Intronic
1161981936 19:7634382-7634404 TTGTGGAACAGAGGAGGCTCGGG - Intronic
1162819659 19:13214745-13214767 GCCTGGCCCAGAGGAGGCCCTGG + Intronic
1162936274 19:13983254-13983276 GTCTGGACCAGCAGCCGCTGTGG + Exonic
1163687785 19:18721934-18721956 GGCAGACCCAGAGGAGGCTGGGG - Intronic
1163919568 19:20276138-20276160 GTGGGGACTAGGGGAGGCTGAGG - Intergenic
1163991138 19:21000215-21000237 CCCTGCACCAGAGGAGACTGAGG - Intergenic
1165553435 19:36607741-36607763 GTCAGGGCCAGATTAGGCTGAGG + Intronic
1165736961 19:38183100-38183122 GTTTGGGCCAGGGGAGGGTGTGG + Intronic
1166364531 19:42271942-42271964 GTCCGGGCCCGAAGAGGCTGAGG + Intronic
1166689745 19:44815217-44815239 GTAGGAACCAGAGGAGCCTGGGG - Intronic
1166741088 19:45115233-45115255 GGCTGGAACAGAGGAGACAGTGG + Intronic
1166744629 19:45135329-45135351 GGCTGGCCCAGAGCTGGCTGTGG - Intronic
1166851400 19:45763210-45763232 CTCTGGAGCTGAGGAGGCAGAGG - Intronic
1166881195 19:45931100-45931122 GCCAGGACCAGAGGCGCCTGTGG + Intergenic
925208340 2:2026309-2026331 GCCCGCACCAGAGGAGACTGAGG + Intronic
925297546 2:2788002-2788024 TTCTGCACCTGAGGCGGCTGAGG - Intergenic
926216813 2:10911138-10911160 GGCTGGAAGAGAGGAGGGTGTGG + Intergenic
926914455 2:17878899-17878921 ACCTGGACCACAGGAGACTGGGG - Intronic
927674460 2:25094871-25094893 GTCTTGAGCCCAGGAGGCTGAGG - Intronic
929464905 2:42135591-42135613 GTTTGGACCATAGGAGGCTTTGG - Intergenic
929469812 2:42180290-42180312 CTCTGGACCAGAGGTAGCTGTGG + Intronic
929507236 2:42537639-42537661 TTCTGGATTAGAAGAGGCTGAGG + Intronic
929541690 2:42827973-42827995 GTCTGGAGAGGAGGAGGCTTGGG + Intergenic
929564284 2:42975061-42975083 GGCTGGAGGAGAGGAGGCAGGGG + Intergenic
929703807 2:44189289-44189311 GTCTGTATGAGAGGAGACTGGGG + Intronic
930617584 2:53609639-53609661 GTCTGGACAACAGGGGGCTTAGG - Intronic
930634253 2:53787160-53787182 TCCTGGAGCAGAGGAGGTTGTGG + Exonic
930692764 2:54381207-54381229 GTCTGGAACAGAGAAGGCAAGGG - Intronic
930760867 2:55034248-55034270 CTCAGGACCGTAGGAGGCTGGGG + Intronic
932430510 2:71671391-71671413 GTCTGCAGCAGAGCTGGCTGGGG - Intronic
933729481 2:85446196-85446218 AGCTGGACCCTAGGAGGCTGAGG - Intergenic
934118965 2:88822274-88822296 GTCTGTACCAGAGGGAACTGGGG + Intergenic
934119109 2:88823328-88823350 GACTGGACCTGAGGAGCCTTTGG - Intergenic
934662163 2:96148778-96148800 GTCTGGCACAGAGCAGGGTGGGG + Intergenic
934685179 2:96316016-96316038 GCCAGAATCAGAGGAGGCTGTGG + Intergenic
934951940 2:98581648-98581670 GGATGGAACAGAGGAGGCTGGGG - Intronic
935712293 2:105909801-105909823 TTGATGACCAGAGGAGGCTGGGG + Intergenic
935720521 2:105975090-105975112 GCCTGGAGCAGAGAAGGCAGAGG - Intergenic
936392510 2:112087979-112088001 GGGTGCAGCAGAGGAGGCTGGGG - Intronic
937288917 2:120770248-120770270 GCCTGGACAGGAGGAGGCTGGGG - Intronic
938262852 2:129907463-129907485 GGGTGGACCAGGGGATGCTGGGG + Intergenic
940004052 2:148995211-148995233 GGCTGGCCCAGAGCAGACTGAGG - Intronic
942865100 2:180663941-180663963 CTCTGGCCCAGAGATGGCTGAGG + Intergenic
945032613 2:205680003-205680025 GTCTTGTTCAGAGTAGGCTGGGG + Intergenic
946094123 2:217257651-217257673 GTCAGACCCAGAGGAGGATGAGG + Intergenic
946772208 2:223100356-223100378 GTTTGTAACAGAGGAGGCTGTGG + Intronic
947795514 2:232891559-232891581 GTCTGGATCCTGGGAGGCTGTGG - Intronic
948202194 2:236137240-236137262 TTCTTGCCCGGAGGAGGCTGAGG + Intergenic
948301817 2:236913395-236913417 GTCTGTACCAGAGGGTCCTGAGG - Intergenic
948740217 2:240041599-240041621 GTCTGGTCCAGAGGAGGAGTGGG + Intergenic
948889791 2:240901977-240901999 CTGGGGACCAGAGGAGGCTTGGG - Intergenic
1170053344 20:12171549-12171571 GGCTGGACCCCATGAGGCTGAGG - Intergenic
1170971846 20:21124265-21124287 GCCCGGCCAAGAGGAGGCTGAGG + Intergenic
1171186510 20:23127428-23127450 GTCTGGGCCACAGGATTCTGAGG + Intergenic
1172122502 20:32607315-32607337 GGCTGGCCCAGGGGAGGCTGAGG - Intronic
1173680170 20:44873537-44873559 GTTGGGACTACAGGAGGCTGAGG - Intergenic
1173781597 20:45761132-45761154 GTGTGGAGGAGCGGAGGCTGAGG - Intronic
1174718636 20:52786871-52786893 CTCTGGAGCAAAGGAGGCTGAGG + Intergenic
1175300260 20:57937943-57937965 GGCTGGACCACAGGAGGTTCGGG + Intergenic
1175450166 20:59058624-59058646 GTCTGGGACTCAGGAGGCTGAGG + Intergenic
1175684208 20:61015449-61015471 GGCTGGCCCAGAAGAGGCTTTGG - Intergenic
1175771031 20:61624483-61624505 GTCTGGATCAGGGGGAGCTGGGG - Intronic
1176131556 20:63498752-63498774 CGCTGGGCCAGAGGACGCTGAGG - Intronic
1176139332 20:63538180-63538202 GGCTGGACAGGAGGAGGCAGAGG - Intergenic
1176209862 20:63914027-63914049 GGGGGGACCACAGGAGGCTGGGG + Intronic
1176301402 21:5100720-5100742 GGCTGGGCCAGGGCAGGCTGTGG + Intergenic
1178976880 21:37227833-37227855 GTCAGGGCCAGCAGAGGCTGCGG + Intronic
1179534848 21:42044975-42044997 GACTGGGCCAGAGGAGGGTTGGG - Intergenic
1179855629 21:44161179-44161201 GGCTGGGCCAGGGCAGGCTGTGG - Intergenic
1180024441 21:45151665-45151687 TTCTAGACAAGAGGAGGCTGAGG + Intronic
1180799508 22:18625223-18625245 ATCTGGAGGAGAGGATGCTGAGG + Intergenic
1180974601 22:19841011-19841033 GTCCTGGCCAGAGGAGCCTGGGG + Intronic
1181222208 22:21370043-21370065 ATCTGGAGGAGAGGATGCTGAGG - Intergenic
1181437953 22:22921272-22921294 GTCTGGCCGATAGGAGGGTGAGG - Intergenic
1181637967 22:24183036-24183058 ATCTGGAGGAGAGGATGCTGAGG - Exonic
1181985538 22:26797832-26797854 GTCTGGCCCAGGGAAGGCTGGGG - Intergenic
1183400665 22:37602011-37602033 AGCTGGGGCAGAGGAGGCTGGGG + Intergenic
1183469595 22:37998397-37998419 GGCTGGCCCTGGGGAGGCTGTGG + Intronic
1183618875 22:38961313-38961335 GCCTGGACCAGGTGGGGCTGGGG - Intronic
1183624078 22:38991258-38991280 GCCTGGACCAGGTGGGGCTGGGG - Intronic
1183732609 22:39627245-39627267 GTCTGGAGCAGACCAGGCTGAGG - Intronic
1184152780 22:42648380-42648402 GTGTGGACATGTGGAGGCTGCGG - Intronic
1184471426 22:44698312-44698334 GTCTGGAGCAGGGGTGGCTCTGG + Intronic
1184471434 22:44698358-44698380 GTCTGGAGCAGAGGTGGCTCTGG + Intronic
1184721658 22:46318066-46318088 GGCTGGAGCTCAGGAGGCTGAGG - Intronic
1184908453 22:47508915-47508937 GCCTGGTCCAGAAGAGGCTGTGG + Intergenic
1185105831 22:48869314-48869336 ATCAGGACCAGACGAGACTGTGG + Intergenic
1185299977 22:50074479-50074501 GTCTGGGCCAGGTGAGGCTGGGG - Intronic
1185330668 22:50250818-50250840 GCCTGGAACAGAGGTGTCTGCGG - Exonic
949186578 3:1199260-1199282 ACCTGGACCTGAGGTGGCTGAGG - Intronic
950207016 3:11088666-11088688 GTCTGGAGCAGAGGATGGAGTGG - Intergenic
950493259 3:13318945-13318967 GCCTGGGCCAAAGGAGCCTGAGG - Intronic
950635910 3:14314490-14314512 GTCTGGAGGTGAGGAGGCTGGGG - Intergenic
950803240 3:15572531-15572553 GTCTGTACCATAGGAGTCCGTGG - Intronic
952820309 3:37480795-37480817 GTCTGGACCAGGAGGGGCAGTGG - Intronic
953252773 3:41261740-41261762 CTCTTGACCAAAGGAGTCTGTGG + Intronic
953726836 3:45406973-45406995 TTCTGGACCAGAAGGTGCTGGGG - Intronic
953981956 3:47417726-47417748 GGCTGGTCCAGAGGAGCCTGGGG - Exonic
954132810 3:48568884-48568906 GTCAGGACCAGATCAGGCTGGGG + Intronic
954420606 3:50417175-50417197 GTCTACACCAGAAGAGTCTGAGG - Intronic
954521031 3:51226703-51226725 GTCTGGACAACAGGAAGCTTTGG - Intronic
955683734 3:61528922-61528944 GTCTGGCCCAGTGGTGGCTCAGG + Intergenic
956077321 3:65519467-65519489 CACTGGAACTGAGGAGGCTGAGG - Intronic
956478061 3:69644311-69644333 GTGTGAACCTGCGGAGGCTGAGG + Intergenic
957426827 3:80050977-80050999 GTCTGGACCAGTGGAGGCTCCGG - Intergenic
959015282 3:101127106-101127128 TTCTGCACTAAAGGAGGCTGAGG + Intergenic
961054137 3:123773661-123773683 CTCTGTAGCAGAGGAGGGTGAGG + Intronic
961441884 3:126958214-126958236 GACTGCACCAGAGGACGCTACGG - Intronic
961469898 3:127105121-127105143 TACTGGAGAAGAGGAGGCTGGGG - Intergenic
961814309 3:129540988-129541010 ATCTGGACTCGGGGAGGCTGTGG - Intergenic
962200782 3:133399786-133399808 GGCTGGATCAGTGCAGGCTGTGG - Intergenic
962947909 3:140188598-140188620 GTCTGGACTAGAGGGGACTGTGG + Intronic
963102256 3:141618947-141618969 GACTGGACCAGAGGGACCTGAGG + Intergenic
966748991 3:183304206-183304228 TTCTGGACCATAGGTGTCTGTGG - Intronic
967678519 3:192330585-192330607 CTCTGCATAAGAGGAGGCTGAGG + Intronic
967825125 3:193871393-193871415 CTCTGGTCAAGAGGAGGCTGAGG - Intergenic
968496359 4:919448-919470 GGCTGGAGAGGAGGAGGCTGGGG - Intronic
968511326 4:997190-997212 GTCTGGAGAAGAGGAGGCCCCGG + Intronic
968936426 4:3612711-3612733 GGCTGGTCCAGTGGAGGGTGGGG + Intergenic
969494387 4:7518076-7518098 GACAGGAACAGAGGAGGCAGTGG + Intronic
969576312 4:8038083-8038105 ATCATGTCCAGAGGAGGCTGAGG - Intronic
969618769 4:8268545-8268567 CTCTGGTCCAGAGGAGGGAGGGG - Intergenic
969932023 4:10640246-10640268 CTCTTGAACTGAGGAGGCTGAGG - Intronic
970513917 4:16808411-16808433 GTAATGACCAGTGGAGGCTGGGG + Intronic
970692356 4:18633887-18633909 GGCTGGAACAGAAGGGGCTGTGG + Intergenic
970804476 4:20014938-20014960 ATCTGGCCAAGAGGAGGGTGAGG - Intergenic
971820389 4:31545922-31545944 ATCTGGAGCAGAGGCTGCTGGGG - Intergenic
973824924 4:54695242-54695264 GTTTAGCCCAGAGAAGGCTGGGG + Intronic
975238830 4:72032393-72032415 GTCTGCACCACAGATGGCTGTGG + Intronic
976074718 4:81284740-81284762 GGCTGGAGCAGAGGGAGCTGGGG - Intergenic
978297207 4:107219706-107219728 TTATGGATCAGAGGAGACTGAGG - Intronic
981267647 4:142805600-142805622 GTCTTCACTTGAGGAGGCTGAGG - Intronic
981331106 4:143511664-143511686 TGCTGGACCCCAGGAGGCTGAGG + Intergenic
985600096 5:823901-823923 GTCTGGGCCAGGGTGGGCTGGGG + Intronic
985723126 5:1501149-1501171 TTCTGGAGCAGAGAAGGCTACGG + Intronic
986564674 5:9100297-9100319 GCTGGGACCACAGGAGGCTGAGG - Intronic
988495573 5:31742587-31742609 GTCTTGAACAGCTGAGGCTGTGG + Intronic
989667634 5:43874619-43874641 GTGGGGACCAGAGGCGGCAGAGG + Intergenic
992458686 5:76940330-76940352 ATCTGGAGCAAAGGAGGCTGAGG + Intergenic
992479500 5:77136559-77136581 TTCAGGACAAGAGGAGGCTGAGG - Intergenic
992863753 5:80937852-80937874 ATCTGGAGCAGAGAATGCTGGGG - Intergenic
994189623 5:96855161-96855183 GACTGGTAAAGAGGAGGCTGAGG - Intronic
998204576 5:140149550-140149572 GGCTGGCTCAGAGAAGGCTGAGG + Intergenic
999103681 5:149049697-149049719 GGCTTGAGCACAGGAGGCTGAGG + Intronic
999695418 5:154184770-154184792 GGCTGGTCCAGACGAGCCTGAGG + Intronic
999806701 5:155087885-155087907 GTCTGGAAAAGAGAAGACTGGGG - Intergenic
999857641 5:155612525-155612547 TTATAGACCAGAGGAGGCTGGGG + Intergenic
999857911 5:155615144-155615166 TTATAGACCAGAGGAGGCTGGGG - Intergenic
999976348 5:156915718-156915740 TCCTTGATCAGAGGAGGCTGTGG - Intergenic
1000114343 5:158139202-158139224 GTTTGGAGGAGAGGATGCTGTGG + Intergenic
1000336635 5:160246142-160246164 GTCAGGAGCACAGGATGCTGGGG + Intergenic
1001806160 5:174588544-174588566 GTCTTGAGCCCAGGAGGCTGAGG - Intergenic
1001818226 5:174689245-174689267 TTCAGAACCAAAGGAGGCTGGGG - Intergenic
1002104591 5:176873880-176873902 GTCTGCACCCCAGGAGGATGAGG - Intronic
1003002318 6:2347731-2347753 GTCTGGACCAAGGGAAGATGAGG - Intergenic
1003092945 6:3119078-3119100 GTCTGGAGCCGTGGAGGCTTGGG + Intronic
1003244168 6:4370175-4370197 GTCTGTAACAGAGCAGGCAGAGG + Intergenic
1004321299 6:14633662-14633684 GTCTGGAGACCAGGAGGCTGGGG - Intergenic
1004405417 6:15328649-15328671 GTCTGGAGTAAACGAGGCTGTGG - Intronic
1004504611 6:16238138-16238160 GCCTGTACTCGAGGAGGCTGAGG + Intergenic
1005938382 6:30542398-30542420 GTGGGGAGCAGAGAAGGCTGAGG - Exonic
1006448713 6:34093614-34093636 GGCTGGAGCAGAGCAGGATGGGG + Intronic
1007229597 6:40339173-40339195 GTCTGTAGGAGAAGAGGCTGGGG - Intergenic
1007406899 6:41640465-41640487 GTCTGGCCCAGCCCAGGCTGGGG - Intronic
1007450641 6:41938833-41938855 GTGTGCAGCAGAGGAGGCTGAGG - Intronic
1011008567 6:82677048-82677070 GACTGGACTAGTGAAGGCTGTGG + Intergenic
1011342806 6:86336151-86336173 GTCTGGGCCACAAGAGGCTTAGG - Intergenic
1013463488 6:110398163-110398185 GTGATGACCAGAGGATGCTGGGG - Intronic
1016350304 6:143159619-143159641 CTCTGGAACAAAGGAGACTGTGG + Intronic
1017309061 6:152955548-152955570 CTGAGGACCAGAGGAGACTGTGG - Intergenic
1017825908 6:158081870-158081892 GACTGGAGCCCAGGAGGCTGAGG - Intronic
1018784891 6:167100416-167100438 GTCTTCACCAGAGGACTCTGTGG - Intergenic
1019522892 7:1468564-1468586 GCCTGGCCCTCAGGAGGCTGGGG + Intergenic
1020129594 7:5552243-5552265 GTCTGGGCCAGAGGGGACAGGGG - Intronic
1020143505 7:5625108-5625130 GTGTGGGCCCGAGGGGGCTGAGG + Intronic
1022092843 7:27118737-27118759 CTGTGGGCCAGAGGAGACTGGGG - Intronic
1023681594 7:42693185-42693207 CTCTTGAGCAGAGAAGGCTGGGG - Intergenic
1024834577 7:53501289-53501311 GGCTGGACCCGAGGAGTTTGAGG - Intergenic
1025812459 7:64883759-64883781 GTCAGGAAAAGAGGAGGCCGGGG - Intronic
1026045696 7:66904176-66904198 AGCTGGACCGGAGGAGGCTTCGG - Intergenic
1027135882 7:75623678-75623700 GGCTGGAGAAGAGGAGGCGGAGG - Intronic
1027309340 7:76937861-76937883 GGCTGGAGCAGAGTAGGATGAGG - Intergenic
1027993994 7:85400239-85400261 GCCTGAGCCTGAGGAGGCTGAGG - Intergenic
1029280084 7:99429865-99429887 AGCTGCCCCAGAGGAGGCTGAGG + Intronic
1029728623 7:102425060-102425082 ATCTGGAACAGAGGAGGAGGAGG + Exonic
1030088867 7:105840038-105840060 GTCAGGATCAGAGGAGTCAGAGG + Intronic
1031963861 7:128013187-128013209 CTCTGGACAGGAGGAGGCAGGGG + Intronic
1032393098 7:131569300-131569322 GCCTGGAGCAGAGGCGGCTGAGG + Intergenic
1034106879 7:148497771-148497793 CTGTGGACCAGGGGAGGGTGGGG + Intergenic
1034526877 7:151670205-151670227 GTATGGAGCAGAGGAGGAAGAGG - Intronic
1035468224 7:159093638-159093660 GTCTGGACCCAGGGACGCTGTGG - Intronic
1036645677 8:10610492-10610514 GTCCACACCAGAGGAGGATGTGG + Exonic
1037124486 8:15330173-15330195 GTCTGGAGAAGAGAAGGCTGGGG - Intergenic
1037490062 8:19389549-19389571 GTCTGGCCCTGAAGAGCCTGGGG - Intronic
1037839442 8:22233307-22233329 GTGCAGGCCAGAGGAGGCTGTGG + Intergenic
1039831929 8:41222263-41222285 GTCCTGACCAGCTGAGGCTGGGG - Intergenic
1040554450 8:48466812-48466834 GTCTTCACCAGAGGACTCTGTGG + Intergenic
1041231858 8:55760344-55760366 GCCAGGACCCGTGGAGGCTGTGG - Intronic
1041340053 8:56835395-56835417 GGCTGCTCCAGAGGAGACTGTGG + Intergenic
1041429469 8:57762915-57762937 GTCTGGTCCAGGTGTGGCTGAGG - Intergenic
1041667888 8:60463612-60463634 GCCTGGAGAAGAGAAGGCTGAGG + Intergenic
1041750450 8:61254882-61254904 GTCTGAGCCAAAGGAGGCTGAGG - Intronic
1043568274 8:81571468-81571490 GGCGGCAGCAGAGGAGGCTGAGG - Intergenic
1045263794 8:100601962-100601984 GTCTGGCCCTGGGGAGGCCGTGG + Intronic
1045395923 8:101760486-101760508 GTCTGGATTAGGGGTGGCTGAGG + Intronic
1045762283 8:105624426-105624448 GTGGGGAACAGATGAGGCTGTGG + Intronic
1046395580 8:113634007-113634029 GTCTGGAGCAGTGGAGGCTCTGG + Intergenic
1047704278 8:127482079-127482101 GTCTGGGGCAGAGCATGCTGAGG + Intergenic
1048267342 8:132999102-132999124 TTCTGGGACACAGGAGGCTGGGG + Intronic
1048329954 8:133464648-133464670 GTGTGTGCCGGAGGAGGCTGGGG + Intronic
1048570638 8:135652491-135652513 GGCTGGACCACAGTGGGCTGGGG - Intronic
1048963720 8:139600172-139600194 CTCTGGGCCAGAGGTGGCTCTGG - Intergenic
1049223634 8:141439371-141439393 GGGTGGATGAGAGGAGGCTGAGG + Intergenic
1049239849 8:141531791-141531813 GTGGGGGCCAGAGGAGGCCGGGG + Intergenic
1049433729 8:142576827-142576849 GTCTTAAGCAGAGGAGCCTGTGG - Intergenic
1049612401 8:143561671-143561693 GTCTGAGCCAGAGAGGGCTGAGG - Intronic
1049951902 9:653200-653222 GTCTGGACATGAAGAGTCTGAGG + Intronic
1051855317 9:21559247-21559269 ATTTGGACAAGAGGAGGCGGCGG + Intergenic
1052908171 9:33855733-33855755 GGCTGGAACAGTGGATGCTGAGG + Intronic
1053002455 9:34584822-34584844 GTCTGGACCAGAGGAGGCTGGGG - Intronic
1056719845 9:89062299-89062321 GTCAGGACCATAGGAGGCCTAGG - Intronic
1057277475 9:93683725-93683747 CTCTGGAGATGAGGAGGCTGAGG - Intergenic
1057725486 9:97565174-97565196 CTGAGGCCCAGAGGAGGCTGGGG - Intronic
1058985647 9:110206965-110206987 GTCTGGGCCAGAGGACGCCTAGG - Intronic
1059699047 9:116757487-116757509 TGCTTGACCAGAGGAGGATGGGG + Intronic
1059858209 9:118425528-118425550 GGCAGAAACAGAGGAGGCTGTGG + Intergenic
1060514828 9:124258846-124258868 GGCTGGGCGAGCGGAGGCTGTGG + Intronic
1060917361 9:127398965-127398987 AGCTGGACCAGAAGAGGGTGGGG + Intronic
1061876500 9:133546685-133546707 GTCTGGAGCAGGAGAGTCTGTGG - Intronic
1061893605 9:133635538-133635560 CTCTGGGCAAGAGGAAGCTGTGG + Intergenic
1062389786 9:136329391-136329413 TTCTGGGCCAGTGGAAGCTGCGG + Intronic
1062502800 9:136858507-136858529 GTGTGGTCCACAGGGGGCTGGGG - Exonic
1062542106 9:137046060-137046082 GTCGGGAGCAGCGGAGGCAGCGG + Exonic
1062695970 9:137876820-137876842 GTGTGGACTGCAGGAGGCTGGGG - Intergenic
1062716325 9:138012043-138012065 GTCAGGGCCAGAGGGGGCAGAGG + Intronic
1185990036 X:4883540-4883562 GTCTTCACCAGAGGACTCTGTGG + Intergenic
1186785261 X:12951058-12951080 GTGTGGAGCAGAGCAGACTGGGG + Intergenic
1187308054 X:18115056-18115078 CTCTGGACCTGAGGAGGCAGAGG - Intergenic
1187691644 X:21874556-21874578 GTCTAGACCAGAGGTGACTGTGG - Intronic
1188440604 X:30212231-30212253 TGCTGGACTGGAGGAGGCTGTGG + Intergenic
1188449203 X:30291132-30291154 GTCTTGAGCAGGTGAGGCTGAGG + Intergenic
1188991094 X:36822001-36822023 CTCTGGAGCTCAGGAGGCTGAGG - Intergenic
1189325419 X:40108434-40108456 GCCTGGACCAGGGGAGGGAGCGG + Intronic
1190195336 X:48313295-48313317 CACTTGAGCAGAGGAGGCTGGGG - Intergenic
1190287672 X:48971669-48971691 GGCTGGACCAGGGAAGGATGAGG + Intergenic
1190369316 X:49726535-49726557 GTCCAGAGCAGAGGAGGCTCTGG - Intergenic
1192502993 X:71665472-71665494 TGCTGGAAGAGAGGAGGCTGGGG + Intergenic
1193626743 X:83831515-83831537 GGCTGGAACAGAGCAGGTTGAGG - Intergenic
1194451109 X:94045854-94045876 GCCTGGACCTGTGGAGGCAGAGG + Intergenic
1195211639 X:102655995-102656017 GTCTAGGCCAGAGGAGGAAGAGG + Exonic
1195272198 X:103242904-103242926 GTCTGGCCCAGAGGATGAGGGGG - Intergenic
1195343769 X:103928464-103928486 GTCTGGCCTGGTGGAGGCTGTGG + Intronic
1195709771 X:107764784-107764806 GTGGGCACCAGAGGAGCCTGGGG - Intronic
1200151650 X:153954213-153954235 GTCTGGCCTAGAGGTGGCGGCGG - Exonic
1200756419 Y:6994451-6994473 GCCGGGACCCGAGGAGCCTGTGG - Intronic
1201144006 Y:11052790-11052812 GGCTGGTCCACCGGAGGCTGGGG - Intergenic