ID: 1053002456

View in Genome Browser
Species Human (GRCh38)
Location 9:34584823-34584845
Sequence GGTCTGGACCAGAGGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002456_1053002467 24 Left 1053002456 9:34584823-34584845 CCCAGCCTCCTCTGGTCCAGACC 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1053002467 9:34584870-34584892 TGCACTCCTTCCCTGAGTGAAGG No data
1053002456_1053002461 -10 Left 1053002456 9:34584823-34584845 CCCAGCCTCCTCTGGTCCAGACC 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002456 Original CRISPR GGTCTGGACCAGAGGAGGCT GGG (reversed) Intronic
900089459 1:913529-913551 GGGGTGGACCAGAGCAGGCAGGG - Intergenic
900498307 1:2986988-2987010 GCCCTGGACCAGACCAGGCTGGG + Intergenic
902440860 1:16429048-16429070 GGCCTGGAGGGGAGGAGGCTAGG - Intronic
902955561 1:19922449-19922471 GGGCTGGACCAGGGGCTGCTCGG + Intronic
903177292 1:21588773-21588795 GCTGGGGAGCAGAGGAGGCTGGG + Intergenic
903320726 1:22541639-22541661 GGCCTGGCCCAGAGGAGGGCGGG - Intergenic
906288572 1:44604343-44604365 GGGCTGGGCCAGTGGAGGGTGGG - Intronic
906495726 1:46302851-46302873 GGTCTGGAGCGAAGCAGGCTGGG - Intronic
908164001 1:61439502-61439524 GGTGTGGACCTGAGCAGGTTTGG + Intronic
908474494 1:64474222-64474244 GGTCTGGTGCAGAGGAGCCATGG + Intronic
908710676 1:67010926-67010948 GATCTGGACAAGGGGAGGCCTGG - Intronic
910629403 1:89340382-89340404 GGTCTGGACCACTGGAGGTGGGG - Intergenic
912701022 1:111878400-111878422 GCCCTGGACAGGAGGAGGCTGGG - Intronic
912950258 1:114115894-114115916 GGACAGTCCCAGAGGAGGCTGGG - Intronic
913201305 1:116496926-116496948 GGTCAGGACAAGAGGAAGCAAGG - Intergenic
913314752 1:117540359-117540381 AGTCTGGGGCAGAGGAGTCTAGG + Intergenic
915328454 1:155093419-155093441 GGTGGGGAGCAGAGGGGGCTGGG + Intergenic
915529474 1:156494980-156495002 GGCTTGGACCACAAGAGGCTGGG - Intronic
915558371 1:156672844-156672866 TGCCTGGACCAGAGGAGCCTGGG - Exonic
915913320 1:159927641-159927663 AGTCTAGAGCAGAGGAGCCTGGG + Intronic
920345294 1:205302418-205302440 GGTGGAGTCCAGAGGAGGCTGGG + Exonic
920963819 1:210686063-210686085 GGAGGGGACCAGAGGAGGCAGGG - Intronic
922237907 1:223735581-223735603 AGGCTGGACCAGAGGTGGTTGGG - Intronic
922345845 1:224695759-224695781 AGTCTGGACCAGATGAAACTAGG + Intronic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
1062996178 10:1869399-1869421 GGGATGGACCAGAGGAGGCAGGG + Intergenic
1064179287 10:13100481-13100503 GGTCAGGACCCGCCGAGGCTTGG - Intronic
1064348458 10:14554538-14554560 GGACTGGACCAGTTGAGACTTGG + Intronic
1065557518 10:26931472-26931494 CCTCTGCACCAGAGGAGGCGGGG + Intergenic
1067450630 10:46379994-46380016 GGTCTTGAGCAGAGGTGGCAAGG - Intronic
1067586613 10:47479757-47479779 GGTCTTGAGCAGAGGTGGCAAGG + Intronic
1071364025 10:84880591-84880613 GGGCTGGAGAAGAGGAGGATGGG - Intergenic
1072743367 10:97923493-97923515 GGTTGGGACCAGAGGAGGTTGGG + Intronic
1074079537 10:110156799-110156821 GGTCTGGACCAGAGTCCCCTGGG + Intergenic
1075020605 10:118949331-118949353 GCTCTGGAGCCGAGGAGGCCTGG - Intergenic
1075166062 10:120069450-120069472 GGTCTGGACCAGAAGGGGTGGGG + Intergenic
1075301803 10:121331379-121331401 GGACTGAGCAAGAGGAGGCTTGG - Intergenic
1075615055 10:123884796-123884818 AGGCTGGCCCAGAGGAGGGTGGG - Intronic
1075701242 10:124470507-124470529 GGTCTGGAACAGCGAAGGCCAGG + Intronic
1077305888 11:1868552-1868574 GGGCTGGCCCTGAGGGGGCTGGG + Intronic
1077317962 11:1927662-1927684 GGGCAGGAGCAGAGGAGGCAGGG + Intronic
1077614071 11:3662443-3662465 GGAGTGGATCAGAGGAAGCTGGG - Intronic
1078869041 11:15327034-15327056 GGTGTGGACCAGGGGACACTTGG + Intergenic
1079948185 11:26769137-26769159 GATCTGGACAAGGGGAGGCCTGG - Intergenic
1080123560 11:28704864-28704886 GGCTTGGACCAGAGTAGGATTGG + Intergenic
1080655186 11:34252803-34252825 CAGCTGGGCCAGAGGAGGCTGGG + Intronic
1081649755 11:44815873-44815895 GGTGGGCACAAGAGGAGGCTGGG + Intronic
1083185536 11:61015803-61015825 GGTCAGGGCCACAGGAGGCTGGG - Exonic
1083333777 11:61911434-61911456 GGGCTGGACCCGAGGAGCCCAGG - Intronic
1083490877 11:63014543-63014565 GGTGGGCAGCAGAGGAGGCTGGG - Intronic
1083672567 11:64307271-64307293 GGCCAGGGCCACAGGAGGCTCGG - Exonic
1083729434 11:64644800-64644822 GGGCTGGGAGAGAGGAGGCTGGG + Intronic
1084043756 11:66557344-66557366 GGGATGGACAGGAGGAGGCTGGG - Intronic
1084566118 11:69930129-69930151 AGGCTGGCCCAGAGGAGGGTGGG - Intergenic
1084636923 11:70398830-70398852 GGTCTGGGCCCAAGGAGGCCGGG + Intronic
1085019107 11:73193944-73193966 GGCCTGGACCTGGTGAGGCTTGG + Intergenic
1085048643 11:73368073-73368095 GGTCTGGACCCCACGGGGCTGGG + Exonic
1085122352 11:73975205-73975227 GCTCTGTCCCAAAGGAGGCTGGG + Intronic
1089055577 11:115582229-115582251 GGTCTGGAGGTGGGGAGGCTGGG + Intergenic
1089841939 11:121426110-121426132 GGGCTGGAGCAAAGGAAGCTGGG - Intergenic
1090632403 11:128661309-128661331 GGGCTGGACCTGTGGGGGCTGGG + Intergenic
1091304794 11:134530364-134530386 GGTGGGGAACAGAGGAGGGTGGG - Intergenic
1091769287 12:3140825-3140847 AGTGTGGACCAGGGGAGGTTTGG + Intronic
1092131986 12:6119204-6119226 GGACTGGAGGAGAGTAGGCTGGG - Intronic
1093923361 12:24884322-24884344 GGTGGTTACCAGAGGAGGCTAGG + Intronic
1095536449 12:43254031-43254053 GGTCGGCACAAGAGGAGGTTAGG + Intergenic
1096122480 12:49097297-49097319 GGACTGGGCCAGGGCAGGCTCGG - Exonic
1096606779 12:52772291-52772313 CGCCTGGACCAGGGGATGCTGGG + Intronic
1096653334 12:53073237-53073259 GGGCTGGGTCGGAGGAGGCTGGG - Intronic
1097169551 12:57105213-57105235 GGCCCTGACCAGCGGAGGCTTGG + Exonic
1098154579 12:67584260-67584282 TGTATGGACCATAGTAGGCTTGG - Intergenic
1098373557 12:69786317-69786339 GGTATGGAGCAGAGAAGGCATGG - Intronic
1100312991 12:93414569-93414591 TGTCTGGAACAGAGAAGGTTAGG - Intronic
1102972040 12:117176452-117176474 GGTCTGGACCAGATTATGCAGGG + Intronic
1103556295 12:121768691-121768713 TGTTTGGACTAGAGGAGCCTGGG + Intronic
1103975763 12:124701541-124701563 GATCTGGAACAGTAGAGGCTGGG - Intergenic
1104323341 12:127772761-127772783 GGTCTGGAACACAGCAGGATGGG + Intergenic
1104803804 12:131572251-131572273 GTTCTGGACCAAAGGAAGCCAGG - Intergenic
1104920806 12:132289780-132289802 CGTCTGGACCAGGGGCTGCTTGG - Intronic
1104959633 12:132482399-132482421 GGACTGGACACGAGGGGGCTGGG - Intergenic
1105070479 12:133231562-133231584 CGTCTGGTCATGAGGAGGCTGGG - Exonic
1105344600 13:19561145-19561167 GGCCAGGGCCACAGGAGGCTCGG + Intergenic
1105535438 13:21260428-21260450 GGCCAGGGCCACAGGAGGCTCGG - Intergenic
1108582497 13:51839119-51839141 GGACTTGACCAGAGCAGCCTGGG + Intergenic
1109323452 13:60837894-60837916 TATCTGGCCCAGAGGAGGCAGGG - Intergenic
1110454005 13:75669603-75669625 GGCCTGCAACAGATGAGGCTAGG - Intronic
1113135156 13:107080775-107080797 TTTCTGGTCCAGAGGATGCTGGG + Intergenic
1113586252 13:111468125-111468147 CGTCTGGACCAGGGGTGGCATGG + Intergenic
1113825424 13:113249054-113249076 GGTCCGGAGCAGAGCAGGCTGGG - Intronic
1117528704 14:56637969-56637991 GCCCTGGACCAGAGCAAGCTGGG + Intronic
1117544971 14:56785873-56785895 TGTCAGGACCAGAGGATGTTTGG - Intergenic
1118765137 14:68904548-68904570 GGGCTGGACGGGAGGAGGCCTGG - Intronic
1119467739 14:74872762-74872784 GGGCTGGACCAGAGATGGATGGG - Intergenic
1119602008 14:75982646-75982668 GGTCGGGAGCCGGGGAGGCTCGG + Intronic
1119771406 14:77222361-77222383 GGCCTGGACCAGGGGATGGTAGG - Intronic
1120615008 14:86693255-86693277 GGACTGGACCTGAGTGGGCTCGG + Intergenic
1121585597 14:95060932-95060954 GGTCTGGACCAGGAGAGCCCTGG + Intergenic
1122635029 14:103125807-103125829 GGTCTGGGCAGGAGGAGGCTGGG + Intronic
1122871535 14:104641080-104641102 GGTCAGGAGCAGAGGGTGCTGGG + Intergenic
1126891946 15:53215908-53215930 GGTTAGAATCAGAGGAGGCTCGG - Intergenic
1127999330 15:64176209-64176231 GGAGTGGACCAGACTAGGCTGGG - Intronic
1128674420 15:69598108-69598130 GGGATGCACCAGAGGAGGCAAGG + Intergenic
1132468287 16:87939-87961 AGGCTGGCACAGAGGAGGCTAGG + Intronic
1132723327 16:1327525-1327547 TGGCTGGGCCGGAGGAGGCTAGG + Intergenic
1134089682 16:11384862-11384884 GGTCTGGGCCCCAGGAGGGTTGG - Intronic
1134169311 16:11955945-11955967 GCAGTGGACCAGAGGAGGCCTGG - Intronic
1135195067 16:20387467-20387489 GGTCTGGAGCAGAGTGAGCTGGG + Intronic
1136606348 16:31336714-31336736 AGAGTGGAACAGAGGAGGCTGGG + Intergenic
1137796918 16:51229186-51229208 AGTGTGGACCAGAGGATGCCAGG - Intergenic
1138533864 16:57649434-57649456 GGTGTGAACCAAAGGAGGCTGGG + Intronic
1138927346 16:61608894-61608916 AGTCTGGAACAGAGCAGGTTTGG - Intergenic
1141092341 16:81138758-81138780 GGTGTAGAGCAGAGGAGGCAAGG - Intergenic
1141431492 16:83972485-83972507 GGGCTGGACCAGAGGAGCCCGGG + Intronic
1142638776 17:1272899-1272921 GGGCTGGACCAGGGCAGGCCTGG - Intergenic
1142758772 17:2030917-2030939 GGGATGGTCCAGCGGAGGCTGGG - Intronic
1142852288 17:2710077-2710099 GGCCTGGCCCAGAGGAAGCTGGG - Intronic
1142874771 17:2845023-2845045 GGCCGGGACCAGATGAGGCGGGG - Intronic
1143105302 17:4526933-4526955 GGACTGGACCAGAGGCCTCTAGG + Intronic
1143125806 17:4640322-4640344 GGTCTGCAGCAGAGGTGGCGAGG + Intronic
1143402670 17:6656500-6656522 GGTCTGCAGCAGAGGTGGCGAGG - Intergenic
1144415714 17:15044311-15044333 GGTCTGGGCCTCAGGACGCTGGG - Intergenic
1145009064 17:19356978-19357000 GGTCTGGAGCAGAAAATGCTTGG - Intronic
1146886111 17:36472099-36472121 GGTCTGGACCACCGGAGCCAGGG + Intergenic
1147251023 17:39152324-39152346 GGTCTGGCCCTGAGTAGGCCTGG - Intronic
1147260387 17:39206666-39206688 GGCCTGGCCCAGAGGAGGAGGGG + Intergenic
1148845746 17:50528855-50528877 GGTCTGGGCCAGGTGGGGCTGGG + Intronic
1150667982 17:67162625-67162647 GGTCTGTAGCAAAGGAGGCTGGG - Intronic
1151620080 17:75240025-75240047 GGGCTGGAGCAGAGGAGCATCGG + Exonic
1152077141 17:78166762-78166784 GGTCTGGTGCAGGGTAGGCTGGG - Intergenic
1153193944 18:2572254-2572276 GGGCAGGACCTGAGAAGGCTGGG + Intronic
1155839671 18:30630028-30630050 GGTCTGCACCAGCGGAGTCAGGG + Intergenic
1156308942 18:35905071-35905093 GGCCTTGACCTGAGGAGTCTTGG + Intergenic
1157428563 18:47604359-47604381 GGGTTAGATCAGAGGAGGCTTGG + Intergenic
1159072626 18:63642923-63642945 GGTCTGGATCAGGATAGGCTGGG - Intronic
1159074067 18:63660562-63660584 GGTCTGGATCAGGATAGGCTAGG - Intronic
1161400584 19:4065170-4065192 GGTCCGGGCCAGAGGAGACGGGG + Intronic
1161981937 19:7634383-7634405 TTTGTGGAACAGAGGAGGCTCGG - Intronic
1162833181 19:13299510-13299532 GTTCTTGAGCAGAGGAGGCTGGG - Intronic
1163664980 19:18598937-18598959 GGTCTGGACTAGCTGAGCCTCGG + Intronic
1163687786 19:18721935-18721957 GGGCAGACCCAGAGGAGGCTGGG - Intronic
1165110311 19:33498521-33498543 GCTGTGGTCCAGAGGTGGCTCGG + Intronic
1165432904 19:35782549-35782571 GGTCTGGGCCAGAGGCGTCCCGG - Intronic
1166337524 19:42117283-42117305 GGCCTGGGGCAGATGAGGCTGGG + Exonic
1166689746 19:44815218-44815240 GGTAGGAACCAGAGGAGCCTGGG - Intronic
1167958507 19:53087212-53087234 TGACTGGAGCAGAGGGGGCTGGG + Intronic
925887970 2:8410077-8410099 GGTCTGGATCAGCAGTGGCTGGG + Intergenic
926914456 2:17878900-17878922 GACCTGGACCACAGGAGACTGGG - Intronic
927192079 2:20523887-20523909 GGCCTGGAAGGGAGGAGGCTGGG - Intergenic
927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG + Intergenic
929541689 2:42827972-42827994 GGTCTGGAGAGGAGGAGGCTTGG + Intergenic
929597724 2:43186783-43186805 GGTCTCGAGCTGGGGAGGCTGGG + Intergenic
929874098 2:45782204-45782226 GGCCTGGACGAGAGGAGGCTTGG - Intronic
930015088 2:46964572-46964594 GGTCTGGAGCTGAGGGGTCTGGG + Intronic
930247926 2:49003872-49003894 GGGATGGGCCAGAGGAGGCAGGG - Intronic
930692765 2:54381208-54381230 GGTCTGGAACAGAGAAGGCAAGG - Intronic
931581495 2:63780267-63780289 TACCTGGACCAGAGGAGGCTTGG + Intronic
932616845 2:73237455-73237477 GGGGTGGACCAGAGAAGACTTGG + Intronic
933989145 2:87621194-87621216 GAACTGGACCAGAGCAGCCTGGG - Intergenic
934951941 2:98581649-98581671 GGGATGGAACAGAGGAGGCTGGG - Intronic
935152515 2:100450509-100450531 GAACTGGGCCAGAGGATGCTAGG - Intergenic
935712277 2:105909708-105909730 GAGCTGCATCAGAGGAGGCTGGG + Intergenic
936048679 2:109206188-109206210 GGTCGAGATTAGAGGAGGCTGGG + Intronic
936267402 2:111021125-111021147 ATTCTGGTGCAGAGGAGGCTGGG + Intronic
936304698 2:111329632-111329654 GAACTGGACCAGAGCAGCCTGGG + Intergenic
937264433 2:120607071-120607093 AGGCTGAGCCAGAGGAGGCTGGG + Intergenic
937280954 2:120716889-120716911 GGCTTGGACCAGGGGAGGCAGGG - Intergenic
937288918 2:120770249-120770271 GGCCTGGACAGGAGGAGGCTGGG - Intronic
939591590 2:144070844-144070866 GAGCTGGACCAGAGGAGTCCCGG - Intronic
944509613 2:200451656-200451678 GGCCAGGAGCAGAGGAGGCTAGG + Intronic
945032612 2:205680002-205680024 GGTCTTGTTCAGAGTAGGCTGGG + Intergenic
945647957 2:212524068-212524090 GGCATGGAAAAGAGGAGGCTTGG - Intronic
946074927 2:217065839-217065861 AGCCTGGAGAAGAGGAGGCTGGG - Intergenic
946321013 2:218954590-218954612 GTTCTGGCCCAAAGGAGGCCTGG + Intergenic
948740216 2:240041598-240041620 TGTCTGGTCCAGAGGAGGAGTGG + Intergenic
948889792 2:240901978-240902000 CCTGGGGACCAGAGGAGGCTTGG - Intergenic
1168966345 20:1900686-1900708 GGCCTGGACCACAGGAGGCTTGG - Intronic
1169273439 20:4217683-4217705 GGACTGGAGCAGAGAAGGCGGGG + Intergenic
1169995787 20:11554690-11554712 GTTCTGGATCTGAGGAAGCTGGG - Intergenic
1172444792 20:34987394-34987416 GGTTTGGAGCTGAGGAGGCAGGG - Intronic
1172880868 20:38199213-38199235 GGTTTTGACCAGAAAAGGCTTGG - Intergenic
1172949433 20:38713278-38713300 GGCCTTGACCAGGGGAGGCGGGG - Intergenic
1173271931 20:41544378-41544400 TGTCTTGACCAGAGGAGTCTGGG - Intronic
1175300259 20:57937942-57937964 GGGCTGGACCACAGGAGGTTCGG + Intergenic
1175983229 20:62751806-62751828 GGCCTGGACCACAGGAAGCTGGG - Intronic
1176027453 20:62993354-62993376 GGCTGGGAGCAGAGGAGGCTGGG + Intergenic
1176143624 20:63555688-63555710 GGCCTGGACAAGATGAAGCTGGG + Exonic
1179534849 21:42044976-42044998 TGACTGGGCCAGAGGAGGGTTGG - Intergenic
1180068254 21:45423565-45423587 GGGCTGACCCCGAGGAGGCTGGG - Intronic
1181985539 22:26797833-26797855 AGTCTGGCCCAGGGAAGGCTGGG - Intergenic
1183400664 22:37602010-37602032 GAGCTGGGGCAGAGGAGGCTGGG + Intergenic
1183931853 22:41239950-41239972 GCTCTGGTCCAGGGTAGGCTCGG + Intronic
1184119544 22:42441106-42441128 GGCCTGGAGAAGGGGAGGCTGGG - Intergenic
1184549741 22:45198130-45198152 GGTCTGGGCCAGAGGAAGCAGGG - Intronic
1184891458 22:47381981-47382003 GGCCAGGACCAGAGGTGGCTCGG + Intergenic
1185299978 22:50074480-50074502 GGTCTGGGCCAGGTGAGGCTGGG - Intronic
1185340452 22:50288594-50288616 GGTCTGGATGAGGGGTGGCTGGG - Intronic
949543514 3:5052922-5052944 GGTCTGGAACACAGGAGGTAGGG + Intergenic
950635911 3:14314491-14314513 TGTCTGGAGGTGAGGAGGCTGGG - Intergenic
951147237 3:19242345-19242367 GTACTGGTGCAGAGGAGGCTGGG + Intronic
952568981 3:34691117-34691139 GGTCTGCACCAGAGAATGCTAGG - Intergenic
953981957 3:47417727-47417749 AGGCTGGTCCAGAGGAGCCTGGG - Exonic
954132809 3:48568883-48568905 AGTCAGGACCAGATCAGGCTGGG + Intronic
956557632 3:70540420-70540442 GGTCTGGACCACTGGAGCCAGGG + Intergenic
963356802 3:144218141-144218163 GGTCTGGAGCAGGGGAAGTTTGG + Intergenic
963761587 3:149291040-149291062 GGTCTGGACCACTGGAGCCAGGG - Intergenic
964307196 3:155354766-155354788 GTTCAGAACCAGAGGAGGCAGGG - Intergenic
966975831 3:185082469-185082491 GGTCTGGATCAGAGCTGCCTCGG - Exonic
967804848 3:193706554-193706576 GAGCTGGACCAGAGGAGTTTAGG + Intergenic
968456421 4:702863-702885 GGTTTGGGCCAGAGCAGCCTTGG + Intergenic
968486624 4:866067-866089 GGCCTGGGCCTGAGGAGGCCTGG + Intronic
968936425 4:3612710-3612732 GGGCTGGTCCAGTGGAGGGTGGG + Intergenic
969550182 4:7860785-7860807 GGTCTGGACCCGTGCAGTCTTGG - Intronic
969628760 4:8323070-8323092 GGGATGGACCAGTGGTGGCTGGG - Intergenic
971299594 4:25430855-25430877 GGACTGGCCCAGAGGAGGGAAGG - Intergenic
973319745 4:48797918-48797940 AATCTGGACAAGAGTAGGCTTGG + Intergenic
973771813 4:54213685-54213707 AGTCTGGACAAGAGAAGGCAAGG + Intronic
973773307 4:54225722-54225744 GGTCTGCCCCAGCTGAGGCTCGG - Intronic
976146892 4:82050948-82050970 GGTCAGCACCAAAGGAGGTTAGG + Intergenic
983932742 4:173471334-173471356 GGTCAGGCCCAGTGGCGGCTTGG - Intergenic
990905741 5:60801224-60801246 GGCCTGGACTAGAGGAATCTCGG + Intronic
997350428 5:133227113-133227135 GCTCTGGACCATTGGAGGATGGG - Intronic
999857640 5:155612524-155612546 ATTATAGACCAGAGGAGGCTGGG + Intergenic
999857912 5:155615145-155615167 ATTATAGACCAGAGGAGGCTGGG - Intergenic
1000336634 5:160246141-160246163 GGTCAGGAGCACAGGATGCTGGG + Intergenic
1001818227 5:174689246-174689268 GTTCAGAACCAAAGGAGGCTGGG - Intergenic
1001952842 5:175828328-175828350 GGTCTGGACGAAAGAAGACTCGG + Intronic
1003092944 6:3119077-3119099 AGTCTGGAGCCGTGGAGGCTTGG + Intronic
1005753330 6:28903709-28903731 GGGCTGAACCAGAGGAAGCCAGG + Exonic
1007229598 6:40339174-40339196 GGTCTGTAGGAGAAGAGGCTGGG - Intergenic
1007364780 6:41383681-41383703 AGTGTGGACCAGAGGAGGGAGGG + Intergenic
1007730480 6:43942490-43942512 GCTCTGGACCGGAGGAGGGAGGG + Intergenic
1011443031 6:87407949-87407971 GCTCCGGACCAGAGGGGGCGGGG - Intergenic
1012189900 6:96266252-96266274 GGTTTGGCCCATAGGAGGCAGGG + Intergenic
1013463489 6:110398164-110398186 GGTGATGACCAGAGGATGCTGGG - Intronic
1017115567 6:150973306-150973328 AGTCAGGATCAGATGAGGCTTGG + Intronic
1018785642 6:167105818-167105840 GGCCTGGACCTGAGCAGGCCTGG - Intergenic
1018990615 6:168670904-168670926 GGTCTGAAATTGAGGAGGCTGGG - Intronic
1019192087 6:170257706-170257728 GGGCTGGACAAGGGCAGGCTGGG - Intergenic
1021270444 7:18578088-18578110 GGTCTGGAGCAGAGCACTCTGGG - Intronic
1022780929 7:33582361-33582383 GGTGTCCATCAGAGGAGGCTGGG + Intronic
1023851576 7:44153128-44153150 GGGCCGGACCAGAGGAGCCAAGG + Intronic
1029325776 7:99807679-99807701 GGTTTGGCCCAGATGAGGATTGG - Intergenic
1032399221 7:131611954-131611976 GCTCTGGACCAAAGGAGTGTGGG - Intergenic
1033508942 7:142035268-142035290 GGTCTTGAGCAGAGTAGGCATGG + Intronic
1034425277 7:151010700-151010722 GGGCTGGAGCAGAGGCAGCTGGG - Exonic
1035709897 8:1705258-1705280 GCTCAGGACCACAGGAGGCTTGG - Exonic
1037124487 8:15330174-15330196 GGTCTGGAGAAGAGAAGGCTGGG - Intergenic
1046562885 8:115862340-115862362 GGTCTCGGCCAGAGGAAGCCTGG - Intergenic
1048570639 8:135652492-135652514 GGGCTGGACCACAGTGGGCTGGG - Intronic
1048692486 8:136983279-136983301 AGTCTGAACCACAGGAGACTTGG - Intergenic
1048979332 8:139694713-139694735 GGGCTGGAGTAGAGGAGGGTGGG - Intronic
1049239848 8:141531790-141531812 GGTGGGGGCCAGAGGAGGCCGGG + Intergenic
1049476870 8:142800994-142801016 GGTCTGGACCAGGGCAGGGCAGG + Intergenic
1052503732 9:29325969-29325991 GGTCTGGATGAGAGGAAGGTTGG - Intergenic
1052995680 9:34550637-34550659 GGTCTGGACCTAAGCAGGCCTGG + Intergenic
1053002456 9:34584823-34584845 GGTCTGGACCAGAGGAGGCTGGG - Intronic
1055030493 9:71768428-71768450 GATCTGGACCCGAGGACGCCAGG - Exonic
1056953585 9:91065331-91065353 GGTCAGGCCCAGAGGAGGGAGGG - Intergenic
1059251728 9:112892099-112892121 GGCCTAGACACGAGGAGGCTGGG - Intergenic
1059848139 9:118304268-118304290 AGTGTGGACCATAGGAGGTTAGG - Intergenic
1060889270 9:127177825-127177847 AGGCTGTACCTGAGGAGGCTGGG - Intronic
1061904848 9:133691339-133691361 GGTCAGGGCCACAGGAGGCCAGG - Intronic
1062423710 9:136496593-136496615 GGTCTGCACCAGGTGAGGCTGGG + Exonic
1062469918 9:136697830-136697852 AGACGGGACCAGAGGAGGATGGG + Intergenic
1062502801 9:136858508-136858530 GGTGTGGTCCACAGGGGGCTGGG - Exonic
1186501025 X:10050615-10050637 GGTCTGGACCTGAGGAATCTGGG + Intronic
1186637417 X:11421447-11421469 GTTCTGAACCAGAGGACCCTGGG - Intronic
1189537597 X:41952302-41952324 GGTGTGGAGCAGAGAATGCTGGG - Intergenic
1190887050 X:54539535-54539557 GGTATAGGCCAGAGAAGGCTTGG + Intronic
1192502992 X:71665471-71665493 GTGCTGGAAGAGAGGAGGCTGGG + Intergenic
1192794432 X:74414657-74414679 GGACTGGAACAGAGGTGTCTTGG - Intergenic
1195709772 X:107764785-107764807 GGTGGGCACCAGAGGAGCCTGGG - Intronic
1197147646 X:123186771-123186793 GGGCAGGAGGAGAGGAGGCTTGG + Intronic
1200986486 Y:9306801-9306823 GGTCTGTCCCAGAGAAGGCCAGG - Intergenic
1202124093 Y:21554101-21554123 GGTCTGTCCCAGAGAAGGCCAGG + Intergenic
1202154915 Y:21875279-21875301 GGTCTGTCCCAGAGAAGGCCAGG - Intergenic