ID: 1053002456

View in Genome Browser
Species Human (GRCh38)
Location 9:34584823-34584845
Sequence GGTCTGGACCAGAGGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002456_1053002461 -10 Left 1053002456 9:34584823-34584845 CCCAGCCTCCTCTGGTCCAGACC No data
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002456_1053002467 24 Left 1053002456 9:34584823-34584845 CCCAGCCTCCTCTGGTCCAGACC No data
Right 1053002467 9:34584870-34584892 TGCACTCCTTCCCTGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002456 Original CRISPR GGTCTGGACCAGAGGAGGCT GGG (reversed) Intronic