ID: 1053002460

View in Genome Browser
Species Human (GRCh38)
Location 9:34584832-34584854
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002452_1053002460 18 Left 1053002452 9:34584791-34584813 CCTCTGCCACAGAATCGGTGTGA No data
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002450_1053002460 25 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC No data
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data
1053002453_1053002460 12 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC No data
Right 1053002460 9:34584832-34584854 CTCTGGTCCAGACCTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type