ID: 1053002461

View in Genome Browser
Species Human (GRCh38)
Location 9:34584836-34584858
Sequence GGTCCAGACCTTTCCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053002452_1053002461 22 Left 1053002452 9:34584791-34584813 CCTCTGCCACAGAATCGGTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002455_1053002461 -9 Left 1053002455 9:34584822-34584844 CCCCAGCCTCCTCTGGTCCAGAC 0: 1
1: 0
2: 2
3: 45
4: 404
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002456_1053002461 -10 Left 1053002456 9:34584823-34584845 CCCAGCCTCCTCTGGTCCAGACC 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002453_1053002461 16 Left 1053002453 9:34584797-34584819 CCACAGAATCGGTGTGATTGCTC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data
1053002450_1053002461 29 Left 1053002450 9:34584784-34584806 CCTCTGACCTCTGCCACAGAATC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053002461 Original CRISPR GGTCCAGACCTTTCCAAGGA AGG Intronic
No off target data available for this crispr