ID: 1053006873

View in Genome Browser
Species Human (GRCh38)
Location 9:34610825-34610847
Sequence TGGCCCTCGTTCCCGAAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053006873_1053006886 21 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006886 9:34610869-34610891 CCCAGGCCAGGGGGTGCTCCTGG 0: 1
1: 0
2: 6
3: 53
4: 523
1053006873_1053006892 28 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006892 9:34610876-34610898 CAGGGGGTGCTCCTGGGGGTTGG 0: 1
1: 0
2: 5
3: 44
4: 510
1053006873_1053006883 11 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006883 9:34610859-34610881 GGGCATGGAACCCAGGCCAGGGG 0: 1
1: 0
2: 2
3: 105
4: 644
1053006873_1053006876 -10 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006876 9:34610838-34610860 ACGAGGGCCACAGCTGGAGCTGG 0: 1
1: 0
2: 4
3: 28
4: 238
1053006873_1053006878 -4 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006878 9:34610844-34610866 GCCACAGCTGGAGCTGGGCATGG 0: 1
1: 0
2: 22
3: 70
4: 676
1053006873_1053006880 4 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006880 9:34610852-34610874 TGGAGCTGGGCATGGAACCCAGG 0: 1
1: 0
2: 11
3: 139
4: 875
1053006873_1053006889 23 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006889 9:34610871-34610893 CAGGCCAGGGGGTGCTCCTGGGG 0: 1
1: 0
2: 0
3: 29
4: 403
1053006873_1053006890 24 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006873_1053006888 22 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006888 9:34610870-34610892 CCAGGCCAGGGGGTGCTCCTGGG 0: 1
1: 0
2: 3
3: 51
4: 383
1053006873_1053006882 10 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006882 9:34610858-34610880 TGGGCATGGAACCCAGGCCAGGG 0: 1
1: 0
2: 8
3: 46
4: 321
1053006873_1053006881 9 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006881 9:34610857-34610879 CTGGGCATGGAACCCAGGCCAGG 0: 1
1: 0
2: 5
3: 51
4: 488
1053006873_1053006877 -9 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006877 9:34610839-34610861 CGAGGGCCACAGCTGGAGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 287
1053006873_1053006884 12 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006884 9:34610860-34610882 GGCATGGAACCCAGGCCAGGGGG 0: 1
1: 0
2: 5
3: 29
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053006873 Original CRISPR TGGCCCTCGTTCCCGAAGAA GGG (reversed) Exonic