ID: 1053006879

View in Genome Browser
Species Human (GRCh38)
Location 9:34610845-34610867
Sequence TCCATGCCCAGCTCCAGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 441}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053006879_1053006888 2 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006888 9:34610870-34610892 CCAGGCCAGGGGGTGCTCCTGGG 0: 1
1: 0
2: 3
3: 51
4: 383
1053006879_1053006889 3 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006889 9:34610871-34610893 CAGGCCAGGGGGTGCTCCTGGGG 0: 1
1: 0
2: 0
3: 29
4: 403
1053006879_1053006883 -9 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006883 9:34610859-34610881 GGGCATGGAACCCAGGCCAGGGG 0: 1
1: 0
2: 2
3: 105
4: 644
1053006879_1053006896 26 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006896 9:34610894-34610916 GTTGGTAACCACACTCATTGGGG 0: 1
1: 0
2: 1
3: 5
4: 106
1053006879_1053006886 1 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006886 9:34610869-34610891 CCCAGGCCAGGGGGTGCTCCTGG 0: 1
1: 0
2: 6
3: 53
4: 523
1053006879_1053006892 8 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006892 9:34610876-34610898 CAGGGGGTGCTCCTGGGGGTTGG 0: 1
1: 0
2: 5
3: 44
4: 510
1053006879_1053006890 4 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006879_1053006882 -10 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006882 9:34610858-34610880 TGGGCATGGAACCCAGGCCAGGG 0: 1
1: 0
2: 8
3: 46
4: 321
1053006879_1053006884 -8 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006884 9:34610860-34610882 GGCATGGAACCCAGGCCAGGGGG 0: 1
1: 0
2: 5
3: 29
4: 362
1053006879_1053006894 24 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006894 9:34610892-34610914 GGGTTGGTAACCACACTCATTGG 0: 1
1: 0
2: 0
3: 9
4: 67
1053006879_1053006895 25 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006895 9:34610893-34610915 GGTTGGTAACCACACTCATTGGG 0: 1
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053006879 Original CRISPR TCCATGCCCAGCTCCAGCTG TGG (reversed) Exonic