ID: 1053006890

View in Genome Browser
Species Human (GRCh38)
Location 9:34610872-34610894
Sequence AGGCCAGGGGGTGCTCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053006879_1053006890 4 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006874_1053006890 23 Left 1053006874 9:34610826-34610848 CCTTCTTCGGGAACGAGGGCCAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006873_1053006890 24 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053006890 Original CRISPR AGGCCAGGGGGTGCTCCTGG GGG Exonic