ID: 1053006890

View in Genome Browser
Species Human (GRCh38)
Location 9:34610872-34610894
Sequence AGGCCAGGGGGTGCTCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053006874_1053006890 23 Left 1053006874 9:34610826-34610848 CCTTCTTCGGGAACGAGGGCCAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006873_1053006890 24 Left 1053006873 9:34610825-34610847 CCCTTCTTCGGGAACGAGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443
1053006879_1053006890 4 Left 1053006879 9:34610845-34610867 CCACAGCTGGAGCTGGGCATGGA 0: 1
1: 0
2: 4
3: 64
4: 441
Right 1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053006890 Original CRISPR AGGCCAGGGGGTGCTCCTGG GGG Exonic
900420151 1:2552773-2552795 AGGCCAGGGGGTCTCCCTGGGGG - Intergenic
900424280 1:2568885-2568907 AGGCCAGGGGGTCTCCCTGGGGG + Intergenic
900531355 1:3155045-3155067 ACTCCAGGGGGTGCTCCATGTGG + Intronic
900564326 1:3324907-3324929 AGGCCAGCGGACGCCCCTGGTGG + Intronic
900595526 1:3478577-3478599 AGAGCAGGAGCTGCTCCTGGCGG - Exonic
900662295 1:3790781-3790803 AGGCTTGGGGGTGCTCCCTGGGG + Intronic
900986055 1:6073304-6073326 AGGGCAGTGGGTGCTGGTGGGGG - Intronic
901041885 1:6368887-6368909 AGGGCAGGGGTTGCTCCAGATGG + Intronic
901456712 1:9367259-9367281 AGCCCAGGGTGGGCTCCTGGTGG + Intronic
901466687 1:9426252-9426274 AGCCCAGGGGCTGCTCCTCAGGG + Intergenic
901758833 1:11457570-11457592 AGGCTAGGGGGTCTTCCTGGAGG - Intergenic
901887125 1:12230697-12230719 GGGCCAGGGCGTGACCCTGGGGG - Intronic
901887148 1:12230782-12230804 GGGCCAGGGCGTGACCCTGGGGG - Intronic
902336695 1:15758534-15758556 AGGCCAGGGGGTGGGAATGGGGG - Intronic
902606840 1:17573698-17573720 AGGCCAGAGGGGACCCCTGGGGG - Intronic
903172236 1:21561336-21561358 AGGGCAGTGGCTGCTCCAGGTGG - Intronic
903235972 1:21951049-21951071 GGGGCAAGGGGTGGTCCTGGTGG + Intergenic
903284040 1:22266213-22266235 GGGCCTGGGGGGCCTCCTGGGGG + Intergenic
903379224 1:22885354-22885376 AGGCCTGGGGAGGCTGCTGGAGG + Intronic
905389018 1:37624385-37624407 AGGGCAAGGGGTGCTTGTGGGGG + Intronic
906125196 1:43423189-43423211 GGGCTAGGGGGTGCTGGTGGGGG + Exonic
909749270 1:79138332-79138354 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
911040681 1:93588659-93588681 AGGGCTGGGGGTGTTCCAGGTGG - Intronic
913412129 1:118563727-118563749 AGGCCTGGAGGTTCTCCAGGGGG + Intergenic
916966163 1:169945067-169945089 AGGCCAGGGGGTGCTGAAGGTGG - Intronic
917278155 1:173352782-173352804 AAGCCTGGGGGTGCTGCAGGAGG + Intergenic
920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG + Intronic
920284609 1:204870597-204870619 AAGCCAGGCTGTGCTCCTGAGGG - Intronic
920522065 1:206635387-206635409 AGGCCACGCGGCGCTCCTAGCGG - Intergenic
920640971 1:207751931-207751953 AGGTCAGGGGGAGGCCCTGGCGG - Intergenic
921069885 1:211649951-211649973 AGGCCTGGGGGTTCAGCTGGAGG - Intergenic
921404648 1:214765312-214765334 AGGCCAAGGGGTGCTCAGGTTGG + Intergenic
921517656 1:216116965-216116987 AAGGAAGGGGGTGCTCCTGAGGG + Intronic
922418208 1:225441307-225441329 AGGCCAGGGTGTGTACATGGAGG - Intergenic
923024724 1:230195482-230195504 ACCCCAGGGAGGGCTCCTGGAGG + Intronic
923043567 1:230337446-230337468 AGGCCACGGGGTGTGCTTGGGGG - Intronic
924385172 1:243493113-243493135 AGGCCAGGGTGTGTGTCTGGAGG - Intronic
1062963089 10:1588492-1588514 AGGCCAGACGGTGCTGCTGTTGG + Intronic
1065092921 10:22252743-22252765 GGGCTTGGGGGCGCTCCTGGAGG + Intergenic
1065690691 10:28330536-28330558 AGGCCAGAGAGTGCTCTTAGAGG - Intronic
1066204987 10:33180231-33180253 TGCCCTGGGGGTCCTCCTGGGGG - Exonic
1066374104 10:34841992-34842014 CTGCTAGGGGCTGCTCCTGGAGG + Intergenic
1067346355 10:45441612-45441634 AGACCTGGTGGTGCGCCTGGAGG - Intronic
1067416358 10:46106252-46106274 AGGCGGCGGGGCGCTCCTGGAGG + Intergenic
1067510878 10:46893940-46893962 AGGGAAGGGGGTGCTGCTTGAGG + Intergenic
1067561993 10:47310591-47310613 AGCCGAGGGTGTGCTCCCGGAGG + Exonic
1067651373 10:48157922-48157944 AGGGAAGGGGGTGCTGCTTGAGG - Intronic
1067802128 10:49366200-49366222 AGGGCCGGGGCTGCTGCTGGTGG + Exonic
1069617613 10:69816179-69816201 AGGCCAGGTGGTAGTCATGGAGG + Intronic
1069966174 10:72119198-72119220 AGGCCAAGTAGAGCTCCTGGAGG - Intronic
1070659113 10:78292399-78292421 GGGCCAGGGAGGGCTCATGGAGG - Intergenic
1071055277 10:81502900-81502922 GGGCCAGTGCGAGCTCCTGGTGG + Intergenic
1072338374 10:94421180-94421202 AGGCCAGGGGGTGGTCACAGGGG - Intronic
1074182740 10:111078002-111078024 CGGCCAACGGCTGCTCCTGGCGG - Exonic
1075102327 10:119515300-119515322 AGGCCTGGGGGGACTCCTGTGGG + Intronic
1076472383 10:130728096-130728118 GTTCCCGGGGGTGCTCCTGGAGG + Intergenic
1076640331 10:131911608-131911630 AGGGCAGGTGGAGCTGCTGGCGG - Intronic
1077096981 11:803207-803229 AGGCCAGGTTGAGCTCCAGGAGG + Exonic
1077103938 11:833759-833781 AGGCCAGGGGCAGGTCCTTGAGG + Intronic
1077105771 11:842067-842089 AGGACATGGGGTGGGCCTGGGGG + Intronic
1077144297 11:1037761-1037783 AGGCCAGCGAGGGCTCCTGTCGG - Intergenic
1077240689 11:1508884-1508906 CGGGCAGGGGCTGCTCCTGCAGG + Intergenic
1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1077921770 11:6646939-6646961 AGGGAAGGGGGTGCTCCAGGAGG + Intronic
1078191522 11:9095457-9095479 AGGCCAGAGGGTTTCCCTGGAGG + Intronic
1079134516 11:17768783-17768805 AGGGCAGGGGGTGCAGCTGGGGG + Intronic
1079366449 11:19814268-19814290 ATGCCAGGGAGTACTCCTGAGGG + Intronic
1080416409 11:32073400-32073422 AGGAAGGGGGGTGCTCCTGGAGG - Intronic
1080579553 11:33631175-33631197 AAGCTATGGGGAGCTCCTGGAGG - Intronic
1081654672 11:44849533-44849555 AGGCCTGGGGGTGCAGATGGGGG + Intronic
1082001792 11:47397207-47397229 AGGCCAGGGAGGGGCCCTGGGGG - Intergenic
1082786266 11:57318726-57318748 TGGCCAGGAGGTGCTTCTTGGGG - Intronic
1083198086 11:61102810-61102832 AGGCAAGGTTGTGCTCCTGGCGG - Intronic
1083270389 11:61569335-61569357 AGGGCAGGGGATGCTGATGGAGG + Intronic
1083844625 11:65323952-65323974 AGGCGATGGGGTGCTGCTGAAGG + Intergenic
1084218525 11:67664422-67664444 GGGCCAGGGGCTTCTCCTGCCGG + Exonic
1084570936 11:69959515-69959537 AGGCCAGGAGTGCCTCCTGGGGG - Intergenic
1084598308 11:70130358-70130380 GGGCCATGGGGGGCTCCTTGTGG - Intronic
1084938515 11:72600159-72600181 AGGGCAGGGGGTGCCCTGGGAGG + Intronic
1084959675 11:72709961-72709983 TGCCCAGGTGGTACTCCTGGAGG + Exonic
1085410412 11:76287448-76287470 AGGGCGGAGGCTGCTCCTGGCGG + Intergenic
1085475407 11:76785703-76785725 AGGCAATGGAGAGCTCCTGGAGG + Intronic
1085940196 11:81198925-81198947 AGGCCAGGGAGTGCAGCTGCAGG + Intergenic
1085959472 11:81443553-81443575 AAGCCTGGGGGTGCTGCAGGAGG + Intergenic
1086552472 11:88069092-88069114 GGGCCAGGGCGAGCTCCCGGTGG + Intergenic
1087400985 11:97667123-97667145 AGGCCAGGGGGAGTTCCAGGTGG + Intergenic
1088227721 11:107639914-107639936 AGGGAATGGGGTGCTCCTGAAGG - Intronic
1089188991 11:116640841-116640863 AGGCCAGGAGGTGCTGTTGCCGG - Intergenic
1089388641 11:118085016-118085038 AGACCAGATGGGGCTCCTGGGGG + Intronic
1089634400 11:119803246-119803268 AGGCCAGGGTCAGCCCCTGGTGG - Intergenic
1090105644 11:123851717-123851739 TGGCCAGGCTGTGGTCCTGGGGG + Intergenic
1090503665 11:127286434-127286456 AGGGCATGGGGGGTTCCTGGGGG - Intergenic
1090512146 11:127386816-127386838 AGTCCAGGTGGTGCTCATGTTGG + Intergenic
1091144576 11:133266415-133266437 AGACCAGGGGGAGATCCTTGAGG - Intronic
1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1091464148 12:669255-669277 AGGCCTGGGGATGCTCTTGGTGG + Intergenic
1092524861 12:9303566-9303588 AAGCCTGTGGGAGCTCCTGGCGG + Intergenic
1092542406 12:9428253-9428275 AAGCCTGTGGGAGCTCCTGGCGG - Intergenic
1092583382 12:9872841-9872863 AGGCCAGGGCGTGCTGCTGCAGG - Intergenic
1093079123 12:14789034-14789056 GGGCCAGGGGGTCGGCCTGGTGG + Exonic
1093079127 12:14789046-14789068 CGGCCTGGTGGTGGTCCTGGAGG + Exonic
1094405381 12:30110767-30110789 AGGCCAGCGGGAGTTCCGGGTGG - Intergenic
1094494376 12:30980213-30980235 AGGCCAGTGGGTGTCCCTGGAGG - Intronic
1094510609 12:31094181-31094203 AAGCCTGTGGGAGCTCCTGGCGG + Intronic
1096417326 12:51425172-51425194 ACACCAGGGGGCGCTCCGGGCGG + Intronic
1096709283 12:53443501-53443523 TTGCCATGGGGAGCTCCTGGGGG - Exonic
1099369394 12:81811628-81811650 AGACCAGAGGGAGCCCCTGGGGG + Intergenic
1099573616 12:84356351-84356373 AGCACAGGTGGGGCTCCTGGAGG + Intergenic
1100349727 12:93768812-93768834 AGGCCATGGGAGGCTTCTGGGGG - Intronic
1101319509 12:103661126-103661148 AGGCCAGGAGGTCCTCATTGAGG + Intronic
1101446725 12:104742276-104742298 AGGCCAGGAGGAGATCCTGAAGG + Intronic
1101749445 12:107571474-107571496 AAGCCAGGGTGGGCTCCTAGGGG - Intronic
1101988846 12:109468221-109468243 AGGCCAGGGTGTGGGGCTGGAGG - Intronic
1102006682 12:109593468-109593490 ATGCCAGGGGGTGCTCTCAGAGG + Intronic
1102157804 12:110744329-110744351 AGGTCAGGGGGGGCTCTTGCTGG + Intergenic
1102495123 12:113314381-113314403 AGCCCAGGGGCTTCGCCTGGAGG - Intronic
1102678444 12:114674170-114674192 AGGCCAGGACGTGCTGCTGGAGG + Exonic
1103199874 12:119079059-119079081 AGGTGAGGGGGTGGTCCAGGAGG + Intronic
1103555944 12:121766498-121766520 AGCCCAGGGGTTACTGCTGGTGG - Intronic
1105344806 13:19561888-19561910 AGGGCAGGGCGGGCTCCAGGCGG - Intergenic
1105844022 13:24279479-24279501 AGACCAGGAGGGGCTGCTGGAGG + Intronic
1113461410 13:110484925-110484947 ATGACAGGAGGTGGTCCTGGGGG - Exonic
1113578991 13:111414680-111414702 AGGTCAGTGGGTGTTCCTGATGG + Intergenic
1114043839 14:18704198-18704220 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114048125 14:18894640-18894662 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114114393 14:19507004-19507026 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1114116088 14:19624757-19624779 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1114210123 14:20606955-20606977 AGGCCAGGGAATCCTCTTGGTGG - Intronic
1114499166 14:23155283-23155305 AGGGCTGTGAGTGCTCCTGGAGG + Intronic
1116998103 14:51345471-51345493 ATGTGAGGGGATGCTCCTGGTGG + Intergenic
1120611337 14:86645882-86645904 AGGCCTGGGGGTTCTCAGGGAGG - Intergenic
1121120315 14:91372101-91372123 AGGGCAGGGAGAGCTCCTTGAGG + Intronic
1121448283 14:93992259-93992281 AGGCCAGTGCTTGCTCCAGGTGG + Intergenic
1121738275 14:96234068-96234090 CGGGGAGGGGGTGCTCCAGGTGG - Intronic
1122477264 14:102019212-102019234 AGGGAAGCGGGTGCTGCTGGTGG - Intronic
1122548842 14:102539277-102539299 GGGCCAGGAGGGCCTCCTGGGGG + Intergenic
1122864459 14:104597249-104597271 GGTCCGGGGGGTGCTGCTGGTGG - Intronic
1122976401 14:105172657-105172679 AGGCCTGGGGGTGGGCCTGCTGG - Intergenic
1123142619 14:106095447-106095469 AGGCCAGGGGCTGGTGTTGGGGG - Intergenic
1202905405 14_GL000194v1_random:68785-68807 CGGACAGGGGCAGCTCCTGGGGG - Intergenic
1124899304 15:33807678-33807700 AGGCCTGGGGGACCTCCAGGCGG - Intronic
1127490083 15:59454044-59454066 AGGCCTGAGGGTGCTGTTGGAGG + Intronic
1127916412 15:63459108-63459130 TGGCCAGCGGGTGTTCCGGGTGG + Intergenic
1129035886 15:72648174-72648196 AGGACAGAGGGTCCACCTGGAGG - Intergenic
1129198149 15:73983185-73983207 AAGCCAAGCGGGGCTCCTGGGGG - Exonic
1129213999 15:74089042-74089064 AGGACAGAGGGTCCACCTGGAGG + Intergenic
1129219350 15:74122398-74122420 TGGCCAAGGGCTGCCCCTGGGGG - Intronic
1129237257 15:74231151-74231173 GGGCCAGGGTGGGATCCTGGAGG - Intergenic
1129400013 15:75276321-75276343 AGGACAGAGGGTCCACCTGGAGG - Intronic
1129458882 15:75690041-75690063 GGCCCAGGCGGTGTTCCTGGAGG + Exonic
1129724926 15:77896851-77896873 GGCCCAGGCGGTGTTCCTGGAGG - Intergenic
1131064151 15:89422623-89422645 CTTCCAGGGGGTGTTCCTGGAGG + Intergenic
1131258828 15:90878048-90878070 AGGGCTGGGTGTGCTCCTTGGGG + Intronic
1132399885 15:101498719-101498741 AGGCCAGGGTCTGGTCCGGGTGG - Intronic
1132556515 16:575086-575108 CTGCCTGGGGGTGCTCCTGAGGG + Intronic
1132583365 16:695175-695197 GGGCCAGCGGCTGCTCCGGGTGG - Intronic
1132587934 16:714441-714463 GGGCCAGACGGGGCTCCTGGAGG - Intronic
1132590582 16:724652-724674 AGGCCTCAGGGTGCTCCTGCAGG + Intronic
1132666531 16:1083528-1083550 GGGCCAGTGGCTGCTTCTGGGGG - Intergenic
1132879016 16:2153065-2153087 TGGTGAGGGGGTGCCCCTGGAGG + Intronic
1132939531 16:2499983-2500005 GGGCAGGCGGGTGCTCCTGGAGG - Intronic
1133019484 16:2960883-2960905 TGGGCAGGGGGTCCCCCTGGAGG - Intergenic
1133285512 16:4688832-4688854 AGGCCAGGTGGGGCTGGTGGTGG - Exonic
1133932722 16:10245188-10245210 AGGCAAGGGGGTGGTGCTGGGGG + Intergenic
1134019324 16:10910578-10910600 AGGTCAGGGGGACTTCCTGGAGG + Intronic
1138513252 16:57521034-57521056 AGACCAGAGGGTCTTCCTGGAGG - Intronic
1138551658 16:57752017-57752039 AGGCCAGGAGGTACTCGTTGGGG - Exonic
1139712177 16:68784435-68784457 AGGGAAGGGGGTGCTGCCGGCGG - Intronic
1139761529 16:69187724-69187746 GGGCAAGGAGGTGCTGCTGGAGG + Exonic
1141160882 16:81628353-81628375 AGGCCTTGGGGTGCAACTGGGGG - Intronic
1141967138 16:87453141-87453163 AAGGAAGGGGGTGCTCCTGGGGG + Intronic
1142177491 16:88651744-88651766 AGACCTGGGGTTGCTCCTGAGGG + Intergenic
1142441820 16:90103318-90103340 AAGCCAGAGGCTGCTCCTGTTGG - Intergenic
1142978141 17:3657195-3657217 GGGCCAGGGTGGGCTCCTGGAGG + Intronic
1143029497 17:3959964-3959986 AGGCCTGATGCTGCTCCTGGGGG + Intronic
1143523973 17:7462040-7462062 GGGGCAGGGGGTGCTGCTTGAGG + Exonic
1143952660 17:10645967-10645989 TAGCCAGGGGGAGATCCTGGTGG - Exonic
1145066648 17:19766149-19766171 AGGGCAGGGGGTGCCCCATGTGG - Intergenic
1145244295 17:21258174-21258196 GGGCAGGGGCGTGCTCCTGGAGG + Intergenic
1145786496 17:27597261-27597283 TGGCCGGAGGGTGCTCCTGCAGG - Exonic
1145899769 17:28482953-28482975 AGACCCGGGAGTGCTCCTGCCGG + Intronic
1146450511 17:32970399-32970421 AGGCCAGGGAGTGCAGCTGCAGG + Intronic
1146677365 17:34782681-34782703 AGACCAGGTGGTGGTTCTGGGGG - Intergenic
1146943861 17:36861234-36861256 AGTCCAGGGTGTGCAGCTGGTGG + Intergenic
1147620825 17:41865505-41865527 AGGCGAGGCGGCGCTGCTGGAGG - Intergenic
1147620829 17:41865525-41865547 AGGCGAGGCGGCGCTGCTGGAGG - Intergenic
1147620833 17:41865545-41865567 AGGCGAGGCGGCGCTGCTGGAGG - Intergenic
1148848075 17:50540811-50540833 AGGCCAGTGGATCCTCCTGGGGG + Exonic
1149506654 17:57200089-57200111 AGACCAGGGTGTGTTCCCGGTGG - Intergenic
1149656238 17:58310894-58310916 CTTGCAGGGGGTGCTCCTGGAGG + Exonic
1150225761 17:63523643-63523665 AGGCAAGCGGGTCCCCCTGGAGG - Intronic
1150249710 17:63699089-63699111 AGGGCAGGGGCAGCTCCGGGAGG + Intronic
1150305707 17:64083700-64083722 AGGCCAGTGGCTGCTCCCAGGGG - Intronic
1151155921 17:72123014-72123036 AGGGCAGGGGGTGTGCCAGGCGG - Intronic
1151162294 17:72175825-72175847 GGGACAGGGGGTGGTGCTGGGGG - Intergenic
1151334417 17:73431704-73431726 AGGGCAGGGTGTGCCCTTGGGGG - Intronic
1151399020 17:73843593-73843615 TGGCTGGGGGTTGCTCCTGGAGG - Intergenic
1151518027 17:74609446-74609468 AGGCCATAGGGAGCCCCTGGAGG - Intergenic
1151578274 17:74963600-74963622 GGGCCAGTGGGTGCTGCTGAGGG - Intronic
1151988521 17:77559127-77559149 TGGCCAGGTGGTGTCCCTGGAGG + Intergenic
1152029812 17:77834987-77835009 AGGACAGAGGGGGCTCCTGGGGG - Intergenic
1152091439 17:78249807-78249829 GGGCCAGGAGGTGCACCTGGGGG + Intergenic
1152245848 17:79184196-79184218 AGGGCAGGAGACGCTCCTGGAGG - Intronic
1152433914 17:80263782-80263804 AGGCCCAGGGGTGCTGGTGGAGG + Intronic
1152554454 17:81045985-81046007 TGGCCTGGGGGGGCTCATGGTGG + Intronic
1152660640 17:81540363-81540385 GGGGCAGCCGGTGCTCCTGGTGG + Exonic
1154321451 18:13356726-13356748 AAGACAGGGGGTGCTCCTGGAGG - Intronic
1155186968 18:23395541-23395563 AGGCCAGGGTCTGCAGCTGGAGG - Intronic
1157304579 18:46507757-46507779 GAGCCAGGGGGTGCTGGTGGAGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158211089 18:55050997-55051019 AGGCCAGGGGGTGATGTTGTAGG + Intergenic
1159549443 18:69879281-69879303 AAGCCTGGGGGTGCTGCAGGAGG + Intronic
1160003976 18:75054554-75054576 AGCCCAGCCGGTCCTCCTGGAGG - Intronic
1160340500 18:78085150-78085172 AGGCCAGGACCTGCTCCTGGGGG + Intergenic
1160403467 18:78628618-78628640 AGGCCAGGTGGTCTTCCTGGAGG - Intergenic
1160524399 18:79526487-79526509 ATGTCAGGAGGTGCTGCTGGCGG + Intronic
1160802553 19:977043-977065 GGGCCGAGGGGAGCTCCTGGAGG + Intergenic
1161242380 19:3229487-3229509 AGGCCAGGAGGGCCGCCTGGAGG + Intronic
1161314892 19:3613214-3613236 GGGCGAGGCGGTGCTCATGGAGG - Exonic
1161579088 19:5070942-5070964 ACGCAAGGGGGTGTCCCTGGTGG - Intronic
1161685472 19:5700660-5700682 AGGCCTGGGGGTGCTGGTCGGGG - Intronic
1162126500 19:8502359-8502381 AGGACAGCGCGGGCTCCTGGGGG - Intronic
1162361170 19:10221375-10221397 CAGCCATGGGGCGCTCCTGGGGG + Intronic
1162583455 19:11544847-11544869 AGGCAATGGGAGGCTCCTGGAGG + Intronic
1162820709 19:13221785-13221807 AGGGCAGTGTGGGCTCCTGGAGG - Intronic
1162937815 19:13990292-13990314 AGGGCAGTGTGGGCTCCTGGAGG + Intronic
1163472598 19:17506037-17506059 GGGCCAGGGGGTGCTGCTGGAGG - Exonic
1165146519 19:33734591-33734613 ATGGCAGGGCGTTCTCCTGGGGG - Intronic
1165316485 19:35059589-35059611 AGGCCAGGAGGGGCTCCGGCTGG + Intronic
1166011127 19:39943530-39943552 TTGCCATGGGGAGCTCCTGGGGG + Intergenic
1166340787 19:42135375-42135397 AGGCCAGGGGCAGCCTCTGGGGG + Intronic
1166745567 19:45140396-45140418 AGGGCAGGGGCTGGGCCTGGTGG + Intronic
1166912612 19:46170762-46170784 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
1167380385 19:49134829-49134851 CGGCCAAGAGCTGCTCCTGGGGG - Exonic
1167438114 19:49491551-49491573 AGGCCAGGGGCTGGTGCTGAGGG + Intronic
925184155 2:1835852-1835874 ATGCCAGGGGCGGCTCCTGCTGG - Intronic
925217771 2:2111819-2111841 GAGCCTGGGGGTCCTCCTGGGGG + Intronic
925361469 2:3283366-3283388 AGGGCAGGAGGTGGGCCTGGTGG - Intronic
925922219 2:8645555-8645577 AGGCCACGGGTGACTCCTGGGGG + Intergenic
926121309 2:10242650-10242672 AGACCAGAGGAAGCTCCTGGAGG - Intergenic
927215609 2:20666672-20666694 AGGCCACAGGATGCTCCCGGCGG - Exonic
927826237 2:26311921-26311943 AGGCGAAGGGGTGGTCCTGTGGG + Exonic
928234848 2:29530499-29530521 AGACCAGGGAGTGCTGCTTGAGG - Intronic
931876812 2:66522433-66522455 AGGCGAGGGGATCCTCCTGTTGG + Intronic
932441970 2:71743286-71743308 TGGCCAGGGGATGCCTCTGGTGG - Intergenic
932490381 2:72116272-72116294 GGGGCTGAGGGTGCTCCTGGGGG - Intergenic
932758882 2:74426706-74426728 AGGTGAGGGGCTGCTCCTGCAGG - Intronic
933139777 2:78779036-78779058 AGGCCAGCGCGAGCTCCCGGTGG + Intergenic
933667114 2:84972035-84972057 AGGCCGGGGCGGGCTCCAGGCGG - Intronic
934929986 2:98414363-98414385 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
935018322 2:99205678-99205700 AAGCCTGGGGGTGCTGCAGGAGG - Intronic
935581727 2:104761505-104761527 AGCCCAGGGGGAGCTGATGGTGG + Intergenic
937670606 2:124533656-124533678 AGCCCAAGGGGTGCTGCAGGAGG + Intronic
937986938 2:127642218-127642240 AGGGCAGGGGTGGCACCTGGGGG - Intronic
938096957 2:128470600-128470622 TGGCCAGTGGGTGCACTTGGGGG - Intergenic
941570912 2:167169284-167169306 AGACCAGGTAGTGCTCCTGAAGG + Intronic
943953560 2:194159331-194159353 AGACCAGGGTGTGGTCCTTGGGG - Intergenic
944654643 2:201865370-201865392 AGACCAGGCCTTGCTCCTGGTGG - Intronic
946320893 2:218953845-218953867 AGGCCAGGGGGCTTCCCTGGAGG - Intergenic
947276487 2:228397542-228397564 AAGCCTGGGGGTGCTGCAGGAGG + Intergenic
947579873 2:231308444-231308466 ATGGCAGAGGGTGCTCCTGGAGG + Intronic
947734397 2:232447161-232447183 AGGCCAAGGGAGGGTCCTGGGGG + Intergenic
947736959 2:232460104-232460126 AGGCCAGGAGGTACTGCTGAGGG + Intergenic
947741281 2:232486133-232486155 CGGCCCGGGGGTGGGCCTGGCGG - Exonic
947816077 2:233038084-233038106 AGGATAGTGGCTGCTCCTGGTGG + Intergenic
948174239 2:235930639-235930661 AGGACAGGGGCTGCTCTCGGTGG + Intronic
948616404 2:239202100-239202122 AGGCGAGCGGGTGCTGCTGGAGG + Intronic
948985449 2:241519879-241519901 AGGCCAGGAGGGGCTGCTGGAGG - Intergenic
1169210500 20:3763930-3763952 TGGCCAAAGGGGGCTCCTGGTGG - Intronic
1169498078 20:6133709-6133731 TGGCTAAGGGCTGCTCCTGGGGG - Intergenic
1169571622 20:6912718-6912740 AGACCAGGAAGTCCTCCTGGAGG + Intergenic
1170999391 20:21397270-21397292 CGGCCTGGGGGCGCCCCTGGGGG - Exonic
1171295407 20:24012668-24012690 AGGCCATGGGCTGGACCTGGAGG - Intergenic
1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG + Intronic
1172134140 20:32675851-32675873 ATGCCAGGTGCTGCTTCTGGAGG - Intergenic
1172244861 20:33438841-33438863 AGGCAAGGAGGTGGTGCTGGAGG - Exonic
1172493407 20:35360022-35360044 AGGCCAGGTGTAGCTCTTGGAGG - Intronic
1172810723 20:37646072-37646094 GGGCCAGGAGGGGCTCTTGGTGG + Intergenic
1174174677 20:48637294-48637316 AGCCAAGGGGGTGCTACTGCAGG - Intronic
1174402387 20:50282991-50283013 AGTCCAGGCGGTGGTGCTGGTGG - Intergenic
1174588619 20:51627641-51627663 AGGGCTGCGGGTGCTCGTGGTGG - Exonic
1175340890 20:58228452-58228474 AGGCCAGGGGCTGCGCGGGGAGG + Exonic
1175366387 20:58459226-58459248 AGGGTTGGGGGAGCTCCTGGTGG - Exonic
1175622988 20:60466466-60466488 AAGCCAAGGTGAGCTCCTGGAGG - Intergenic
1175943667 20:62549187-62549209 AGCCCAGGAGGTGAACCTGGAGG + Intergenic
1176007941 20:62876313-62876335 AGGCCACAGCGTGCTCCTGGAGG + Intergenic
1176118898 20:63445395-63445417 AGGCCTGGGGGAGGGCCTGGGGG + Intronic
1176128076 20:63484912-63484934 AGGGCAGGAGGAGCTTCTGGCGG - Intergenic
1176178446 20:63739226-63739248 AGCCGAGGCGGTGCTCCTGCCGG + Intronic
1176624775 21:9083544-9083566 CGGACAGGGGCGGCTCCTGGGGG - Intergenic
1179171891 21:38979630-38979652 AGGTCAAAGGGTGGTCCTGGGGG - Intergenic
1179712678 21:43272393-43272415 AGACCAGGGGGTGCTCACTGAGG + Intergenic
1179724656 21:43335420-43335442 AGACCAGGTGGTGCTTCTGGGGG + Intergenic
1179793779 21:43770595-43770617 AGGAGAGGGGCTGCCCCTGGAGG + Intergenic
1179802608 21:43818025-43818047 AGGCCCGGGGCAGCCCCTGGGGG - Intergenic
1179805059 21:43832227-43832249 TGGCCAGTGGGAGCCCCTGGCGG + Intergenic
1180001378 21:44996994-44997016 AGGATAGTGGGTGCCCCTGGAGG + Intergenic
1180466660 22:15617314-15617336 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1180684562 22:17655261-17655283 AGGGCAGGTGGTCCTCCAGGAGG - Intronic
1180955266 22:19738603-19738625 AGGGCAGGGAGTGGGCCTGGAGG - Intergenic
1181032238 22:20154266-20154288 AGGCCAGGGGAGGGTCCTGGAGG - Intergenic
1181235421 22:21445456-21445478 TGGCTTGGGGGAGCTCCTGGGGG - Exonic
1181511224 22:23389462-23389484 AGGCCAGGGGAGGTTCCTGAAGG + Intergenic
1181521425 22:23450680-23450702 ATCCCAGCGGGTGCTGCTGGAGG - Intergenic
1181588477 22:23867774-23867796 TGGGAAGGTGGTGCTCCTGGAGG + Intronic
1181669857 22:24420970-24420992 AGGCCAGGGGGTGGTCAGGCAGG - Intronic
1182299610 22:29330305-29330327 ATGCCAGGGGGTGGCCCTGGTGG - Intronic
1183347256 22:37314743-37314765 AGGCCCAGGGGAGCCCCTGGAGG + Exonic
1183459395 22:37940860-37940882 AGCCCAGGAGCTGCTCCAGGAGG - Exonic
1183544330 22:38447564-38447586 AGGAGAGGGGAGGCTCCTGGGGG + Intronic
1183828647 22:40406614-40406636 AGACCAGGGCCAGCTCCTGGGGG + Exonic
1184091315 22:42294437-42294459 AGGCCAGGGAAGGCTGCTGGGGG + Intronic
1184195698 22:42926312-42926334 AGGCCGATGGGTGCTTCTGGAGG - Intronic
1184258948 22:43303438-43303460 AGGCCCCGGGGTGGGCCTGGTGG + Intronic
1184411547 22:44329074-44329096 AGGCAGTGGGGAGCTCCTGGGGG - Intergenic
1184445513 22:44544761-44544783 GGGCTAGGGGGAGCCCCTGGAGG - Intergenic
1184591043 22:45483473-45483495 AGGTCAGGGAGGGCTCCAGGTGG + Intergenic
1185320666 22:50198917-50198939 GGCCCAGGGGCGGCTCCTGGGGG + Exonic
950052447 3:10002874-10002896 AGGCCATGGGGTCATGCTGGGGG - Intronic
951718507 3:25674040-25674062 AGGCCAGGGGTTGCTGAGGGTGG - Intergenic
952959766 3:38581960-38581982 AGGCCTGGGGCTGCTGCTGTAGG + Intronic
953320168 3:41964165-41964187 AGGCCAGGGTGTGCAGCTGCAGG + Intergenic
953697419 3:45170891-45170913 AGGCCTGGGGGTACCCCTGCTGG - Intergenic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
954435795 3:50495284-50495306 AGGCCAGGAGGGGTTCCTGTGGG - Intronic
954652934 3:52176263-52176285 GGCCCATGGGGTGATCCTGGTGG - Intergenic
954671645 3:52294303-52294325 AGGCCTGGGGCTGCTCTTGCAGG + Intergenic
955320936 3:57973779-57973801 GGGCCTGGTGGTGCTGCTGGTGG + Intergenic
956787590 3:72655369-72655391 AGGCCCGGCGGTGCTCACGGGGG - Intergenic
957778944 3:84793355-84793377 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
957966167 3:87324238-87324260 AGGCCAGAGGGCTTTCCTGGAGG + Intergenic
958481650 3:94651986-94652008 TTGCCAGGTGGTGCTCCAGGAGG - Intergenic
958758385 3:98276572-98276594 AGGCCAGGGAGTGCAGCTGCAGG + Intergenic
958980124 3:100709985-100710007 TGGCCAGGAGGCGCGCCTGGGGG + Intronic
960126566 3:114005150-114005172 AGCCCAGGGGCTGCTCCATGTGG + Intronic
960959357 3:123058394-123058416 AGGCCAAGGGGTGGGCCTGCAGG + Intergenic
961344287 3:126252504-126252526 TGGCCACTTGGTGCTCCTGGAGG - Intergenic
961821720 3:129578701-129578723 AGGCCAGGGAGCACTCATGGAGG - Intronic
961823475 3:129586912-129586934 AGCCCAGAAGGAGCTCCTGGTGG - Intronic
962713425 3:138106904-138106926 GGGTCAGGGGCTGTTCCTGGAGG - Intronic
963091344 3:141486772-141486794 GGGCCGGGGCGTTCTCCTGGTGG + Intergenic
963232736 3:142925280-142925302 AGACCTGGTAGTGCTCCTGGAGG + Intergenic
963603531 3:147396380-147396402 AGGCCTGGGGAGGCTCCTCGTGG + Exonic
963615535 3:147532369-147532391 AGGCCAGCATCTGCTCCTGGAGG + Intergenic
964802235 3:160568798-160568820 AGGCCAGGGGGCTTCCCTGGAGG + Intergenic
966852088 3:184170636-184170658 CGGCCCGGAGGGGCTCCTGGGGG - Exonic
966949467 3:184803311-184803333 AGGCCTGGGGGTGGTAGTGGAGG - Intergenic
967630888 3:191742052-191742074 AGGCCAGGGAGTGCAGCTGCAGG - Intergenic
968132106 3:196197949-196197971 TGGCCAGGGGGTGCGGGTGGCGG - Intronic
968362085 3:198154285-198154307 AAGCCAGAGGCTGCTCCTGTTGG - Intergenic
968706344 4:2080203-2080225 AGGCCTGGGGGTGCTGCAAGTGG - Intronic
968978610 4:3834808-3834830 AGGTCAGGGTGTGCACCGGGGGG + Intergenic
969299180 4:6287434-6287456 AAGCCAGGAGGTCATCCTGGAGG - Intronic
969490904 4:7498785-7498807 GGGCCAGGGGTTGCTCATGCTGG - Intronic
969532829 4:7739332-7739354 AGGCCTGGGGGTGAGCATGGGGG - Intronic
969616085 4:8253280-8253302 TGGGCATGGGGTGCTCCTGGAGG + Intergenic
971376486 4:26059785-26059807 AGGGCAAGGGCTGCTCCTAGAGG + Intergenic
973201893 4:47513118-47513140 AGACCAGGGGCTGCCTCTGGGGG + Intronic
973323279 4:48831410-48831432 AGGCGACGGAGTGCTTCTGGGGG + Exonic
978165453 4:105601633-105601655 TGGCTAAGGGATGCTCCTGGGGG + Intronic
978505617 4:109453351-109453373 AAGCCTGGGGGTGCTGCTGGAGG + Intronic
979712056 4:123791328-123791350 TGGCCAGGGGGAGGACCTGGTGG + Intergenic
980044619 4:127973779-127973801 AGGCCAGCCTCTGCTCCTGGAGG - Intronic
980577210 4:134698919-134698941 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
980595460 4:134948468-134948490 AGGCCAGGGTGAGTTCCAGGTGG - Intergenic
981107062 4:140893100-140893122 AGGCCGGGGGGTGGTCATGGTGG - Intronic
982089078 4:151864843-151864865 AGGCTATGCGGTGTTCCTGGTGG - Intergenic
982110356 4:152047679-152047701 AGCCCAGGGGGTGCTCTTCCAGG - Intergenic
986140118 5:5021634-5021656 AGGGCATGGGGAGCTCCTGGAGG + Intergenic
987140165 5:14937705-14937727 GGGACACGGGGTGCTGCTGGGGG + Intergenic
987710225 5:21495173-21495195 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
988749388 5:34179000-34179022 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
989126454 5:38057044-38057066 AGAACAGGGGTTACTCCTGGGGG - Intergenic
991737643 5:69642192-69642214 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991760551 5:69914233-69914255 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991786781 5:70203868-70203890 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991789219 5:70221918-70221940 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991817101 5:70518308-70518330 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991839782 5:70789283-70789305 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991879227 5:71204253-71204275 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991881667 5:71222282-71222304 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
992240799 5:74767322-74767344 ACTCCAGCGGCTGCTCCTGGCGG + Exonic
992860331 5:80902779-80902801 AAGCCTGGGGGTGCTGCAGGAGG + Intergenic
993735931 5:91476975-91476997 TGGCCGGGTGGTTCTCCTGGAGG - Intergenic
994460193 5:100062262-100062284 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
994484341 5:100375687-100375709 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
995034738 5:107520575-107520597 AGGCAAGGGGGAGCTCCTAGTGG + Intronic
996432918 5:123401346-123401368 AGGCCAGAGGGCTTTCCTGGAGG - Intronic
998003612 5:138642990-138643012 AGACCAGGGTGAGCTACTGGGGG - Intronic
998890081 5:146736628-146736650 AGGAAAGGGGGTGGTGCTGGGGG - Intronic
999257560 5:150218016-150218038 AGGGCAGGGGAGGCCCCTGGAGG + Intronic
1001021717 5:168188762-168188784 ATTCCAGGGCCTGCTCCTGGAGG + Intronic
1001295240 5:170494502-170494524 AGGAAAGGTGGTGCTCTTGGGGG + Intronic
1001431786 5:171667908-171667930 CGGCCCAGGGCTGCTCCTGGCGG + Intergenic
1001576946 5:172770898-172770920 AGGCCTGCGGGCGCTGCTGGGGG - Exonic
1002785796 6:398939-398961 AGTGCAGGGTTTGCTCCTGGAGG + Intronic
1003065364 6:2900407-2900429 AGGCCAGTCCCTGCTCCTGGCGG + Intronic
1004053181 6:12108707-12108729 AGGCCAGCTGGAGCTCCGGGTGG - Intronic
1004912225 6:20297571-20297593 AGGCCAGGTGGTGACCTTGGTGG - Intergenic
1005547462 6:26885346-26885368 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1006085659 6:31593130-31593152 GGGCCAAGGAGGGCTCCTGGAGG - Intergenic
1007173287 6:39879334-39879356 AGGCAAGGTGGGGCACCTGGGGG - Exonic
1009018224 6:57926413-57926435 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1010066270 6:71686203-71686225 AGGCCAGCGGGAGTTCCGGGTGG + Intergenic
1010742522 6:79525788-79525810 AGGCCAGGGAGTGCAGCTGCAGG + Intronic
1011344456 6:86353637-86353659 AGGCCAGGCCAGGCTCCTGGAGG + Intergenic
1013560619 6:111301145-111301167 AAGCCTGGGGGTGCTGCAGGAGG - Intronic
1013610913 6:111794115-111794137 AGGCCCGGGTGTCCTCATGGCGG - Intronic
1014360884 6:120471967-120471989 AGGCCAGGGTGCGAGCCTGGTGG + Intergenic
1015871617 6:137781388-137781410 AGGTCAGTGAGAGCTCCTGGGGG + Intergenic
1017192633 6:151670066-151670088 AGGCCAGAGGCTGGCCCTGGTGG - Intronic
1017430880 6:154369657-154369679 TGGCAAGGCTGTGCTCCTGGAGG + Intronic
1017473703 6:154766648-154766670 AGGGGGGGGGGTGCTGCTGGAGG - Intronic
1018576424 6:165264519-165264541 AGGTAAGGAAGTGCTCCTGGGGG - Intergenic
1019002836 6:168769980-168770002 AAGCCTGGGGGTGCTGCAGGAGG + Intergenic
1019253595 7:34422-34444 AAGCCAGAGGCTGCTCCTGTTGG + Intergenic
1019331500 7:462873-462895 AGGCCTTAGTGTGCTCCTGGAGG - Intergenic
1021729857 7:23585748-23585770 AGGCCATGTGGTGCACTTGGTGG + Intergenic
1021934209 7:25614219-25614241 AGGGCAGGGATGGCTCCTGGAGG + Intergenic
1022089460 7:27098050-27098072 AGGCAAGGCAGTCCTCCTGGAGG + Intergenic
1022902206 7:34822089-34822111 AGGCCAGGGAGTTCTCCCGGGGG - Intronic
1024045431 7:45582549-45582571 AGGCCAGGGCAGGCACCTGGCGG + Intronic
1024048121 7:45599197-45599219 TGGGCAGGGGCTGCTCCAGGAGG - Intronic
1024946135 7:54809120-54809142 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
1025131176 7:56374951-56374973 AGGGCAGGAGGTGATCCTGGAGG + Intergenic
1025246937 7:57324593-57324615 AAGCCTGGGGGTGCTGCAGGAGG - Intergenic
1025927301 7:65970269-65970291 AGACAAGGGGGTGAGCCTGGGGG - Exonic
1027703446 7:81498359-81498381 AGTCAAGGCTGTGCTCCTGGAGG + Intergenic
1027957244 7:84896431-84896453 AGGCCAGTGGTTGCCACTGGAGG + Intergenic
1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG + Intronic
1028639709 7:93029013-93029035 AGGCCAAGGGGTGCTCAGGTGGG - Intergenic
1029434514 7:100555053-100555075 AGGGCAGGGAGTGAACCTGGAGG + Intronic
1029706262 7:102277942-102277964 GGGCCAGGCGGTTCTCCTGGGGG - Intronic
1032078943 7:128849137-128849159 AGGCCAGGCGGTGCTCAACGTGG - Intronic
1033451380 7:141465119-141465141 AGGCCATGGTCTGCTCCTGCTGG + Intronic
1034458733 7:151186533-151186555 AGGCCAGACAGTGCCCCTGGGGG - Exonic
1035022300 7:155806905-155806927 ATCCCAGAGGGTGCCCCTGGAGG - Intronic
1035258040 7:157644417-157644439 AGGCCAGGGCAGGCCCCTGGAGG + Intronic
1035354855 7:158270789-158270811 AGGTGAGGGGGTGGTCCAGGTGG - Intronic
1036016162 8:4787206-4787228 CCGCCAGGGGGCGCGCCTGGGGG + Intronic
1038130776 8:24728912-24728934 ACAGCAGGGGGTGCTCCAGGGGG + Intergenic
1039546768 8:38416135-38416157 TGGCCGGGGTGTGCTGCTGGGGG - Intronic
1039597687 8:38805623-38805645 AGCACAGGGTGTGCTGCTGGTGG + Intronic
1040493871 8:47949087-47949109 AGGCATGGGGGTGCCTCTGGAGG - Intronic
1041370206 8:57151395-57151417 AGGCCAGCGGCTGGGCCTGGGGG - Intergenic
1041990800 8:63988995-63989017 GGGACAGGGGGTGGTCATGGGGG + Intergenic
1045026179 8:98089251-98089273 TGGCCAGGGGCTGTTCTTGGAGG - Exonic
1047203596 8:122785827-122785849 AGGCTTGGGGGTGCACATGGAGG + Intronic
1047496221 8:125410934-125410956 AGGCCAGTGGGTGCTACAGAAGG + Intergenic
1049224184 8:141441822-141441844 AGGGCAGGGGGTGGCCCAGGGGG - Intergenic
1049230826 8:141480303-141480325 CAGGCAGGGGCTGCTCCTGGAGG + Intergenic
1049354386 8:142180306-142180328 AGGCCAAGTGATGCTCCTGCTGG + Intergenic
1049472487 8:142782690-142782712 GGGCCTGCGAGTGCTCCTGGAGG - Intergenic
1049575155 8:143386481-143386503 TGCCCAGGGGTTGATCCTGGAGG + Intergenic
1049653832 8:143789124-143789146 CGGGCAGGGGGTGCTGGTGGGGG + Intergenic
1049659724 8:143814444-143814466 AGGCCAGTGTGGGCCCCTGGAGG - Intronic
1049790925 8:144472415-144472437 AGGCCAGGGCGGGATCCAGGTGG + Exonic
1052771987 9:32698296-32698318 GGGCCATGGCGTGCTCTTGGAGG - Intergenic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1053271009 9:36749508-36749530 AGGGGAGAGGGTGCTCCTGGAGG + Intergenic
1053416249 9:37948605-37948627 AGGGCTGGGGGTGCTCGGGGCGG + Intronic
1054701633 9:68418816-68418838 AGGCCATGGGGTGCTAGAGGGGG - Intronic
1056667103 9:88589745-88589767 AGGCCAGTGGGGACTTCTGGAGG - Intergenic
1057190910 9:93087170-93087192 AGGCCAGAGAGTGTGCCTGGTGG + Intergenic
1057384315 9:94593890-94593912 AGGCCAGAGGGAGTTCCTTGAGG - Intergenic
1057594894 9:96407245-96407267 ACCCCAGGGGCTGCTCCTGGCGG + Intronic
1057842816 9:98500258-98500280 ATGGCAGGGGGTGCCCCTGGGGG + Intronic
1057910310 9:99015264-99015286 AGGCGAAGGTGTGGTCCTGGAGG + Intronic
1060211444 9:121712983-121713005 AGGGCAGGGGCCGCTCCAGGTGG - Intronic
1060995888 9:127874761-127874783 AGGGCAGAGGGGGCTGCTGGGGG + Intronic
1061014049 9:127971805-127971827 AGGCCAGGGAGGCTTCCTGGAGG + Intronic
1061202803 9:129147253-129147275 AGGCCTGGGGGATCCCCTGGCGG + Intronic
1061678077 9:132229524-132229546 AGGGCACGGGGAGGTCCTGGGGG - Intronic
1061716312 9:132520711-132520733 AGGGCTGGGGATCCTCCTGGAGG - Intronic
1061848380 9:133400702-133400724 AGGCCAGGAGACACTCCTGGTGG + Intronic
1062005550 9:134236928-134236950 AGGAGTGGGGGTGCTCCTGGAGG + Intergenic
1062032122 9:134366478-134366500 TGGCCACGGCGAGCTCCTGGCGG + Intronic
1062264864 9:135682319-135682341 AGGGCAAGGTGTGCCCCTGGAGG - Intergenic
1062374226 9:136254735-136254757 CGGCCAGGCAGTGCTCCTGGGGG - Intergenic
1062393525 9:136343364-136343386 AGGGCAGGGGGCGGTCCTGCAGG - Intronic
1062596885 9:137303546-137303568 AGGCCCTGGGGTCCTCCTGGTGG + Intergenic
1062746772 9:138217947-138217969 AAGCCAGAGGCTGCTCCTGTTGG - Intergenic
1203747938 Un_GL000218v1:53972-53994 CGGACAGGGGCGGCTCCTGGGGG - Intergenic
1187275616 X:17814262-17814284 TGGCCAAGGGCTGCTCCTGGAGG + Intronic
1190301386 X:49059413-49059435 AGGACAGAGGCTACTCCTGGCGG - Intronic
1191249461 X:58253558-58253580 ATGCTATGGGGTGCCCCTGGTGG + Intergenic
1195544605 X:106100751-106100773 AGGCCAAGGGGTGCTCAGGTTGG + Intergenic
1199299619 X:146197706-146197728 AGGCCAAGGTGTTCTCCTGGTGG + Intergenic
1200088658 X:153624300-153624322 AGGTCAGGGGGTGTTCCATGTGG - Intergenic
1200143053 X:153911162-153911184 AGGCCAGCCTGTGCCCCTGGTGG - Exonic
1201161284 Y:11168966-11168988 CGGACAGGGGCAGCTCCTGGGGG - Intergenic