ID: 1053008173

View in Genome Browser
Species Human (GRCh38)
Location 9:34618097-34618119
Sequence CACATGAGCAGGGCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053008165_1053008173 20 Left 1053008165 9:34618054-34618076 CCTTGAGGAGAGCCTTCAATGAG 0: 1
1: 0
2: 0
3: 16
4: 152
Right 1053008173 9:34618097-34618119 CACATGAGCAGGGCTCCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 186
1053008167_1053008173 8 Left 1053008167 9:34618066-34618088 CCTTCAATGAGGAGCTGATACCC 0: 1
1: 0
2: 0
3: 16
4: 86
Right 1053008173 9:34618097-34618119 CACATGAGCAGGGCTCCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053008173 Original CRISPR CACATGAGCAGGGCTCCACC AGG Intronic
900802227 1:4744501-4744523 CACGTGAGCAGGTCTGCATCTGG - Intronic
904369747 1:30040813-30040835 CACATGAGCAAGGCTACAGGAGG + Intergenic
905012460 1:34756721-34756743 CACTTGAGCAGGACTCTGCCTGG + Intronic
905278070 1:36831942-36831964 CACATGAACTGTTCTCCACCTGG + Intronic
906508691 1:46398439-46398461 GAGATAAGCAGGGCTCCAGCAGG + Intronic
907274285 1:53308647-53308669 CACATGAGCAGGGAATCAGCAGG - Intronic
909713925 1:78684154-78684176 GACATGAGCAGTGCTACACGTGG + Intergenic
912326711 1:108770321-108770343 CACATGACCATGGCTAAACCTGG + Intronic
913194404 1:116443609-116443631 CTCATAAGCAGAGCTCCAGCTGG - Intergenic
914212817 1:145596386-145596408 CACATGACCAGGGCTCTCACCGG - Intergenic
918058027 1:181039328-181039350 CCCATGAGAAGGGATCCACTGGG - Intronic
920084996 1:203408890-203408912 CACTTGAGCTGGTCCCCACCTGG - Intergenic
922697181 1:227736324-227736346 CACATGAGCAGGGCTGAAGTGGG + Intronic
923036512 1:230288394-230288416 CTCATGAGCAGGGCTGGTCCTGG - Intergenic
923656065 1:235918166-235918188 CACTCCAGCAGGGATCCACCAGG + Intergenic
924926757 1:248691626-248691648 CACGTGAGCCGGGAGCCACCAGG + Intergenic
1063125754 10:3135548-3135570 CACAGGAGCAGAGCTGCACGAGG + Intronic
1065155793 10:22869045-22869067 CAGATCAGCATGGCTCCCCCAGG + Intergenic
1066756821 10:38720128-38720150 CACATGTGTAGGACTCCACTGGG - Intergenic
1067062734 10:43086275-43086297 CTCATGAGCAGGTCTGCTCCGGG - Intronic
1067429410 10:46233258-46233280 CGCATGAGGAGGGGACCACCTGG - Intergenic
1069791704 10:71026817-71026839 TGCATGAGCAGGGCTCCATCAGG - Intergenic
1070408534 10:76118030-76118052 CACAACAGCATGGCTCTACCAGG - Intronic
1070421518 10:76242156-76242178 CCCAGGAGCAGGGAACCACCAGG - Intronic
1070773972 10:79099319-79099341 CCCATGAGCAGGGGTGCTCCTGG + Intronic
1071781847 10:88854988-88855010 CACATGTGCAGTGGCCCACCAGG + Intergenic
1076417717 10:130303345-130303367 CACAGGAGAGGTGCTCCACCTGG - Intergenic
1076418100 10:130306832-130306854 AACATGAACAGTGCTGCACCAGG + Intergenic
1076930818 10:133530540-133530562 CACACGAGCACAGCTTCACCAGG + Intronic
1077464905 11:2729116-2729138 CCCATGAGCTGGGCTCTCCCGGG + Intronic
1078488103 11:11742603-11742625 CTCAGGAGCAGGACTCCACTTGG + Intergenic
1080741012 11:35064332-35064354 CAAATGAGCAGGGCCCCTGCTGG + Intergenic
1081850441 11:46271887-46271909 CACAGGAGCAGGGCTCCCTGGGG - Intergenic
1084004211 11:66314692-66314714 CACATGGCCGGGGCTGCACCAGG - Exonic
1084693484 11:70740319-70740341 CCCATGAGAAGGGCTCCCTCTGG + Intronic
1085323059 11:75586611-75586633 AACAGGAGCAGGGACCCACCTGG - Intergenic
1085325170 11:75601085-75601107 CACGTGCTCAGGGCTCCCCCAGG - Intronic
1085525458 11:77161119-77161141 CCCATGAGCAGAGCCCCACGCGG - Intronic
1085815080 11:79728429-79728451 CACAGGAGCTGGGCTCGACGGGG - Intergenic
1086618202 11:88849982-88850004 CACAGAAGCAGGCCACCACCCGG + Exonic
1088440499 11:109865717-109865739 CTCATGAGCAGGGCCCCGCTGGG + Intergenic
1088991437 11:114956968-114956990 CACAAAAGCAGAGCTCCAACTGG + Intergenic
1089194794 11:116688001-116688023 CCCATGCCCAGGGATCCACCAGG - Intergenic
1090370178 11:126245128-126245150 CCCAGGAGCAGGGGACCACCAGG + Intronic
1092085621 12:5756823-5756845 CAGATGAGCAGGGCTGCCCCTGG + Intronic
1102215936 12:111161289-111161311 CACAGCAGCAGGGCTCCATAGGG + Intronic
1104736478 12:131138606-131138628 CACCTGAGCAGGGCTCCAGCAGG - Intronic
1106897872 13:34324617-34324639 CACATGAGCATTCCTGCACCCGG - Intergenic
1108733440 13:53258219-53258241 CCCATGAGCTGGGGACCACCAGG + Intergenic
1110273416 13:73616529-73616551 AATATGAGCATGGATCCACCTGG + Intergenic
1111952110 13:94716943-94716965 CTCCTGAGCAGGGCTCAAGCAGG + Intergenic
1115121454 14:29942146-29942168 CACAGGAGCAGGGCTGCCCAAGG + Intronic
1118636274 14:67751361-67751383 CCCAGGAGCAGGGGACCACCAGG - Intronic
1119193078 14:72697450-72697472 GACATGAGCAGGACTTCAGCAGG + Intronic
1119734525 14:76973470-76973492 CAGATGATCAGGGCCCCGCCTGG - Intergenic
1120872730 14:89352541-89352563 CACTGGCCCAGGGCTCCACCGGG - Intronic
1122489048 14:102101207-102101229 CATATTAGCAGGGCTCCAGAAGG + Intronic
1122676579 14:103419828-103419850 CCCAAGAGCAGGGGTCTACCAGG + Intronic
1123054438 14:105562369-105562391 CACCTGCCCAGGGCTCCCCCAGG - Intergenic
1123079022 14:105682788-105682810 CACCTGCCCAGGGCTCCCCCAGG - Intergenic
1124690068 15:31814421-31814443 CACATGAACAGGGCTACAGCAGG - Intronic
1126736746 15:51737978-51738000 CAATGGAGCAGGGGTCCACCTGG - Exonic
1127899344 15:63329712-63329734 CACTTGACCAGGGCTCTCCCAGG - Intronic
1128554088 15:68618566-68618588 CACATGAGCAGTGCTCTTCCTGG + Intronic
1130283356 15:82536175-82536197 CACAGGAGCTGGGCTGCACTTGG - Intergenic
1131370232 15:91874979-91875001 ACCATGAGCAGGGGTCAACCAGG - Intronic
1132828130 16:1914960-1914982 CAGATGAGGTGGGCTCCACAAGG - Intronic
1136578940 16:31140576-31140598 CTGATGGGGAGGGCTCCACCCGG + Exonic
1136725765 16:32356065-32356087 CACATGTGTAGGACTCCACTGGG + Intergenic
1136844098 16:33562116-33562138 CACATGTGTAGGACTCCACTGGG + Intergenic
1137784407 16:51126052-51126074 TTCAAGAGAAGGGCTCCACCCGG - Intergenic
1139522992 16:67495932-67495954 GTCATAAGCAGGGTTCCACCAGG + Intergenic
1140409116 16:74730742-74730764 CACATAACCAGGGCTCCATGGGG - Intronic
1141272723 16:82555775-82555797 CACAGGAGCAGGGCTGCCCAAGG - Intergenic
1142304995 16:89279948-89279970 CTCCTGACCAGGCCTCCACCCGG - Exonic
1203000665 16_KI270728v1_random:161689-161711 CACATGTGTAGGACTCCACTGGG - Intergenic
1203132268 16_KI270728v1_random:1698094-1698116 CACATGTGTAGGACTCCACTGGG - Intergenic
1203154263 16_KI270728v1_random:1862415-1862437 CACATGTGTAGGACTCCACTGGG + Intergenic
1145007022 17:19343877-19343899 CAGGTGAGCAGGGCCCCACCTGG + Intronic
1146181700 17:30702630-30702652 CCCAAGAGCAGGGGACCACCAGG - Intergenic
1147538236 17:41334778-41334800 GACATGGCCAGGGCTCCACAAGG - Intergenic
1148777172 17:50102246-50102268 CACAGGGCCAGGGCTCCTCCAGG - Intronic
1150266979 17:63838180-63838202 CAGGTGAGCAGGGCTGCAACAGG + Intronic
1153276441 18:3372376-3372398 CAGATGAGCAGTGCTCCAGGCGG - Intergenic
1159920635 18:74224350-74224372 CCAATGAGAAGGGCTCCACTCGG + Intergenic
1159921049 18:74227647-74227669 CCCAGGAGCAGGGGACCACCAGG + Intergenic
1161354427 19:3810994-3811016 CACATGAGCCCGGTGCCACCAGG + Intronic
1162977133 19:14213175-14213197 CCCAAGAGCAGGGGACCACCAGG + Intergenic
1164416404 19:28049667-28049689 CACATGAGCTGAGCTCCATTAGG + Intergenic
1164553512 19:29232430-29232452 CACAAGGGCAGGGCTGCACCTGG + Intergenic
1164671902 19:30077110-30077132 AACACGAGAAGGGCTCCCCCAGG + Intergenic
1164685140 19:30161516-30161538 CACATGAGCAGGATGCCTCCAGG - Intergenic
1165175604 19:33927485-33927507 CCCAGGAGCAGGGGGCCACCAGG - Intergenic
1165933599 19:39375833-39375855 CAGAGGAGCAGGGCTCCAGCCGG + Exonic
1166505235 19:43367251-43367273 CCCAGGAGCAGGGCTCTTCCTGG - Intergenic
1166509322 19:43393844-43393866 CCCAGGAGCAGGGCTCTTCCTGG + Intergenic
1166550188 19:43660625-43660647 CCCAGGAGCAGGGGACCACCAGG - Intronic
1166971125 19:46568603-46568625 AATATGACCATGGCTCCACCTGG + Intronic
1168275060 19:55273425-55273447 CACATACGAAGAGCTCCACCAGG + Intronic
925003114 2:421866-421888 CACACGAGCAGGTGTCCATCAGG - Intergenic
925170029 2:1744576-1744598 CACATGCGCGAGGCTCCTCCCGG + Intronic
925770655 2:7279801-7279823 GATATGAGCAGAGTTCCACCAGG - Intergenic
926169636 2:10544384-10544406 AACTTGAGCAGGGCTCCACTGGG - Intergenic
928251069 2:29681160-29681182 CACAGGAGCAGGGGACTACCAGG - Intronic
931688761 2:64817520-64817542 CCCAGGAGCAGGGAACCACCAGG + Intergenic
934320119 2:91964505-91964527 CACATGTGTAGGACTCCACTGGG - Intergenic
935899249 2:107773068-107773090 TACCTGAGCAAAGCTCCACCTGG - Intergenic
937231164 2:120398923-120398945 CAGATGAGCAGGCATCCTCCTGG - Intergenic
940612779 2:156011331-156011353 CAGCTGAGAAGGGCTCCAGCTGG + Intergenic
944539259 2:200740963-200740985 CTCATGAGCTGGGCTCCCCATGG - Intergenic
947622903 2:231602433-231602455 CACTTGTGCAGGACTCCACAGGG - Intergenic
947639926 2:231701572-231701594 CACATGAGCAGGCACACACCTGG - Intergenic
948412888 2:237778405-237778427 CACATTAGCAGGGCATCATCTGG - Intronic
1169193148 20:3670253-3670275 GACAGGGGCAGGGCACCACCTGG - Intronic
1169631155 20:7633691-7633713 CCCATGAGCAGGAGACCACCAGG - Intergenic
1172891543 20:38269448-38269470 CACATGATGATGGCTCTACCAGG + Intronic
1174115990 20:48226599-48226621 CGCCTGAGCAGGGCTTCCCCAGG + Intergenic
1175900559 20:62358332-62358354 CACTTGAGCAGGGCTCCCTGGGG - Intronic
1175904386 20:62372354-62372376 CACAGGACCACGGCTCCAGCAGG + Intergenic
1179988631 21:44934296-44934318 GTCAGGAGCTGGGCTCCACCAGG + Intronic
1180145571 21:45916742-45916764 GACATGGACAGGGCTGCACCAGG - Intronic
1180308371 22:11148559-11148581 CACATGTGTAGGACTCCACTGGG - Intergenic
1180546848 22:16510372-16510394 CACATGTGTAGGACTCCACTGGG - Intergenic
1181281366 22:21723019-21723041 CCCAGGAGCAGGGGACCACCAGG - Intronic
1181385074 22:22538753-22538775 ACAATGAGCAGGGCACCACCAGG + Intergenic
1182212333 22:28686985-28687007 CACATGTGTAGGACTCCACTGGG + Intergenic
1183647570 22:39135256-39135278 CAAAGGGACAGGGCTCCACCTGG + Intronic
1184231498 22:43160575-43160597 CCCATGATCAGGCCTCCCCCTGG + Intronic
1184232775 22:43167597-43167619 CTCGGGAGCAGGGTTCCACCGGG - Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949856898 3:8470128-8470150 CCCATGAGATGGGCTCCACCAGG + Intergenic
950109809 3:10411857-10411879 CACATGATGAGGGGTGCACCTGG - Intronic
950282458 3:11719656-11719678 AACCTGAGCCGGGCTCCGCCAGG + Intronic
950310387 3:11952921-11952943 CTCAGGAGCAGGGGACCACCAGG - Intergenic
950974060 3:17221561-17221583 AACATGAGAAGGGCTTGACCTGG + Intronic
951055875 3:18145808-18145830 CACATTCCCAGGGCTCTACCTGG + Intronic
951981763 3:28575110-28575132 CAGCAGGGCAGGGCTCCACCAGG - Intergenic
954601296 3:51872308-51872330 CCTAGGAGCAGGGCACCACCAGG + Intergenic
955220060 3:57015974-57015996 CACAGAGGCAGGGGTCCACCTGG + Intronic
955406126 3:58626930-58626952 CCCATGACCAGGGCCCCAACAGG + Intronic
960350128 3:116582679-116582701 CCCAGGAGCAGGGAACCACCAGG - Intronic
962241770 3:133756245-133756267 CACATCAGCAGGGCTCCTGCAGG - Intronic
962811005 3:138959625-138959647 CACATGGCCAAGGCTGCACCTGG - Intergenic
966895761 3:184443850-184443872 CAGAAGAGCAGGGGTCCATCTGG - Intronic
968317347 3:197736286-197736308 GACAGGGGCAGGGCACCACCCGG - Intronic
970254210 4:14150515-14150537 CACAAGAGTAGGGATCCACTGGG - Intergenic
971546338 4:27891448-27891470 CACAGGAGCAGGGCTGCCCAAGG + Intergenic
972587769 4:40454020-40454042 CAAATGTGCAGGTCTCCAGCAGG - Intronic
978858433 4:113419982-113420004 CCCAGGAGCAGGGGACCACCAGG + Intergenic
980931308 4:139185581-139185603 CCCAGGAGCAGGGGACCACCAGG + Intergenic
983787047 4:171745774-171745796 AACGTGGGCAGGGCTCCACAGGG + Intergenic
983942411 4:173549173-173549195 TACATGAGCAGGTTTGCACCTGG + Intergenic
985716110 5:1462727-1462749 CAAATGAGCAGGGCCCGAGCTGG - Exonic
985789372 5:1916929-1916951 CACAAGAGCTGGTGTCCACCCGG - Intergenic
995628800 5:114110372-114110394 CACCTGAGCTGGTCTTCACCTGG - Intergenic
996086079 5:119306475-119306497 CCCAGGAGCAGGGGACCACCAGG - Intronic
998028274 5:138839901-138839923 CACATGTGAAGAGCACCACCAGG - Intronic
998816271 5:146017377-146017399 CACATGTGCAGGGCCCTCCCTGG + Intronic
1002422687 5:179157378-179157400 CACATGGTCAGGGCAACACCTGG + Intronic
1005915012 6:30344243-30344265 CAGACAAGCAGGGCTCCAGCTGG - Intronic
1006398354 6:33801624-33801646 CAGATGACCAGGGCTCTGCCTGG + Intronic
1006428394 6:33980315-33980337 GACAGGAGCTGGTCTCCACCTGG - Intergenic
1006759911 6:36451046-36451068 CCCAGGAGCAGGGATCCACCAGG - Intronic
1008353406 6:50520541-50520563 CTCATGTGCACCGCTCCACCTGG + Intergenic
1011519244 6:88186349-88186371 CACTTGAGAAGAGTTCCACCTGG - Intergenic
1013467535 6:110430577-110430599 CACGTGAGCACTGCTGCACCTGG - Intronic
1017467369 6:154706998-154707020 AACAAGAGCAGGGCCACACCTGG - Intergenic
1019743084 7:2684779-2684801 CAGATGAGTAGGGCCCCTCCTGG - Intronic
1022504659 7:30902735-30902757 AAAATGACCAGGGCCCCACCAGG + Intergenic
1023998156 7:45174592-45174614 GACATGACCAGGGCTGCATCAGG - Intronic
1027977640 7:85179358-85179380 CACAGGAGCAGAGCTTCCCCAGG + Intronic
1029728462 7:102424238-102424260 CACATGTGCAGGGCTTGCCCTGG - Intronic
1032151018 7:129429779-129429801 CATATGAGCACGGCTCCCCATGG + Exonic
1032447931 7:132000687-132000709 GACATGCTCAGGGCTCCATCAGG + Intergenic
1033175933 7:139123673-139123695 CACCTGAGCAGGTCTCTTCCTGG + Intergenic
1033367849 7:140684911-140684933 CACAGGAACAGGGCTCCAAGGGG + Intronic
1034536529 7:151729063-151729085 CACTTGTCCAGGGTTCCACCAGG + Intronic
1035470486 7:159106090-159106112 CACCTGAGCAGGGCACCTGCAGG + Intronic
1035829226 8:2676458-2676480 TGCATGAGCAGGGCACCTCCTGG - Intergenic
1035999153 8:4582603-4582625 CACATTAGCAAGGATGCACCTGG + Intronic
1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG + Intronic
1043476864 8:80613671-80613693 CACGGGAGCAGGGGACCACCAGG - Intergenic
1046424994 8:114035316-114035338 CACATGAGCAGGCTTCCAGGAGG + Intergenic
1047479790 8:125270746-125270768 CTCAGGAGCAGGGAACCACCAGG + Intronic
1048439209 8:134447596-134447618 CACATCACCAGGTCTCCACTTGG - Intergenic
1048906803 8:139096591-139096613 CACATGAGAAGGGCTGCCTCAGG - Intergenic
1053008173 9:34618097-34618119 CACATGAGCAGGGCTCCACCAGG + Intronic
1053421044 9:37978613-37978635 AATATGAGCAGGGCCCCACAGGG + Intronic
1053491012 9:38502419-38502441 CACATGAGCACTTCTCCATCGGG + Intergenic
1054720267 9:68596446-68596468 CCCATGAGCAGGACTCCCTCTGG - Intergenic
1054846975 9:69808387-69808409 CACATAAGCATGGCTCCAAAGGG - Intergenic
1056663133 9:88559234-88559256 GCCATGAGCAGGCCTCCTCCCGG - Intronic
1056927004 9:90843854-90843876 CACCTGCGCAGGTGTCCACCTGG - Exonic
1057041743 9:91853195-91853217 CAAAACAGCAGGGCTCCTCCGGG + Intronic
1057162129 9:92896228-92896250 CACATGACCTGGGTTCCACCTGG - Intergenic
1059294268 9:113255896-113255918 CCCAGGAGCAGGGAACCACCAGG + Intronic
1062333180 9:136053446-136053468 CTGATGAGCTGGGCTCCACCGGG + Intronic
1189211625 X:39288821-39288843 TACATGAGCAGGGCAGCAGCAGG + Intergenic
1191718666 X:64210832-64210854 CCCAGGAGCAGGGGACCACCAGG + Intergenic
1195004588 X:100673237-100673259 CTCCTGAACAGAGCTCCACCTGG + Intergenic
1201187640 Y:11419613-11419635 CACATGTGTAGGACTCCACTGGG - Intergenic