ID: 1053008421

View in Genome Browser
Species Human (GRCh38)
Location 9:34619901-34619923
Sequence GGTCTGAAAGGACCAGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053008421_1053008424 -5 Left 1053008421 9:34619901-34619923 CCTAATCCTGGTCCTTTCAGACC 0: 1
1: 0
2: 0
3: 12
4: 245
Right 1053008424 9:34619919-34619941 AGACCTCACTTCTCACCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053008421 Original CRISPR GGTCTGAAAGGACCAGGATT AGG (reversed) Intronic
901877582 1:12175634-12175656 GGACAGGAAGGAGCAGGATTAGG - Intronic
902298966 1:15487792-15487814 GGTCTCAAAGTATCAGGTTTTGG - Intronic
902455842 1:16533573-16533595 AGTCTGACTGTACCAGGATTCGG - Intergenic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
903192557 1:21665041-21665063 GGTCTAAAAGGACATAGATTGGG - Intronic
904762271 1:32814301-32814323 GATCTGATAGGGCCTGGATTTGG - Intronic
906126200 1:43428392-43428414 GGGCTGAGAGGACCAGGACTTGG - Exonic
906737904 1:48150409-48150431 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
907048719 1:51315568-51315590 GGTCTGAAAGGACCAGAAAGTGG - Intronic
907908225 1:58804468-58804490 GGTTTGGAAGGAGCAGGCTTTGG + Intergenic
909273662 1:73656812-73656834 GGTGTGAAAGGCCAAGTATTTGG + Intergenic
914761486 1:150602363-150602385 GGAAGGAAAGGACCAGGACTTGG + Intronic
918439405 1:184551520-184551542 ATTCTGGAAGGACCAGGATCTGG + Intronic
919050008 1:192500865-192500887 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
921432240 1:215079054-215079076 GATCTGAAAGCACCAGAATAAGG + Intronic
921573792 1:216809779-216809801 TCTCTGGAAGGACCAGGATGTGG + Intronic
921746527 1:218746610-218746632 TATCTGAGAGGACCAGTATTGGG - Intergenic
922753305 1:228081276-228081298 GGGCTGAAGGGACCTGGCTTTGG - Intergenic
923270817 1:232353660-232353682 GTTCTGAAAAGACCTGGAATGGG + Intergenic
924882138 1:248172285-248172307 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1063723347 10:8608683-8608705 CTTCTCAAAGGACCAGCATTTGG - Intergenic
1064702507 10:18036370-18036392 GGTCTGAAAAGCGCAGTATTCGG + Intronic
1067260763 10:44689238-44689260 GGTCTGAAATGGCAATGATTGGG - Intergenic
1069201243 10:65619182-65619204 GGTCTGAAGGGACCAAGCTTTGG - Intergenic
1069838440 10:71324360-71324382 GGTCTTACAGAACCAGGAATAGG - Intronic
1070580350 10:77714308-77714330 GTTCTGCGAGGACTAGGATTAGG - Intergenic
1070631584 10:78088733-78088755 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1072297287 10:94022839-94022861 GATCTTAATGGACAAGGATTGGG + Intronic
1074451800 10:113565365-113565387 GGACTGGAAAGTCCAGGATTGGG + Intronic
1076102438 10:127793954-127793976 GTTCTGAAAGCATCAGGATGGGG + Intergenic
1076842779 10:133054495-133054517 GGACAGAGAGGACCAGGAATGGG + Intergenic
1078337881 11:10478070-10478092 TCTCAGAAAGGACCAGGAATAGG - Intronic
1078807025 11:14716190-14716212 GGTCTGAAAAGCGCAGTATTCGG - Intronic
1079059041 11:17231765-17231787 TGTCTGTAGGGAGCAGGATTGGG - Intronic
1079085377 11:17441136-17441158 GCTCTGAAAGGAGTAGAATTAGG - Intronic
1080234869 11:30056928-30056950 GGTCGGAAAAGAGCAGTATTCGG + Intergenic
1080382030 11:31781795-31781817 GGTATGAAAGGCTCAGGAATCGG - Intronic
1080696667 11:34608757-34608779 GGCCTGATAGAACCAGGATGTGG - Intergenic
1081535987 11:43996575-43996597 GGGGTGACAGGACCAGGTTTTGG + Intergenic
1081678128 11:44982891-44982913 GGCCTGAAAGGGCAAGGATCCGG - Intergenic
1081786014 11:45748061-45748083 GGTCCGACAGGACTGGGATTTGG - Intergenic
1083414674 11:62517819-62517841 GGTCTGAAAGGTTCAGAAGTAGG - Exonic
1088801526 11:113311619-113311641 GGGATGAAAGTATCAGGATTTGG + Intergenic
1088941485 11:114462694-114462716 GGTCTGACAGTACCAAGAATTGG + Intergenic
1089290630 11:117435954-117435976 GTCCTGATAGGACCAGAATTTGG - Intronic
1091652057 12:2318096-2318118 GGTCTGACCGGCCCAGGGTTTGG + Intronic
1093325931 12:17774089-17774111 GGTCTGAAAAGCGCAGTATTTGG + Intergenic
1094083193 12:26560209-26560231 GGTCAGAAAGGAGGAGGATCAGG - Intronic
1095643515 12:44513141-44513163 GGCCTAAAAGGGCCATGATTAGG + Intronic
1095983762 12:47986710-47986732 AATCTGAAAGGACCCAGATTGGG + Intronic
1096633452 12:52944389-52944411 GGTGTCAAAAGACCTGGATTCGG - Intronic
1097807030 12:63976837-63976859 GGTCAGAAAGGACCCAGACTAGG - Intronic
1097838036 12:64293073-64293095 GGTCTGAAAAGCGCAGTATTCGG + Intronic
1099420162 12:82447960-82447982 AGCCTGAAAGAACCAGGATCAGG + Intronic
1101315944 12:103628962-103628984 TGTCTGGCAGGGCCAGGATTAGG - Intronic
1101738962 12:107484891-107484913 GGTGTTAAAGGAACAGGTTTGGG + Intronic
1103256565 12:119546609-119546631 GGACTGAAATGAGCAGTATTGGG - Intergenic
1105269625 13:18859815-18859837 GGCCTCAAATGACCAGGAGTAGG + Intergenic
1106712155 13:32349441-32349463 GGTCTCAAAAGACTAGGAATTGG + Intronic
1109069539 13:57747201-57747223 GATTTGAAAGGAACATGATTGGG + Intergenic
1109329804 13:60915006-60915028 GGTCAGCAAGAACCAGGGTTAGG + Intergenic
1110358175 13:74593273-74593295 GGTGTGAAATGACAAGGATGAGG - Intergenic
1110674528 13:78225091-78225113 GGTCAGAGAAGCCCAGGATTAGG + Intergenic
1112720192 13:102235592-102235614 GGTCAAAAAGGATCAGGATCAGG + Intronic
1113759485 13:112837517-112837539 GCTCTGAACGGCACAGGATTTGG - Intronic
1114572884 14:23686618-23686640 TGTCTGAAAGCACCAGCATTAGG + Intergenic
1114801881 14:25784576-25784598 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1116617046 14:47153372-47153394 GGTCTCTAAGGACCTGGATTTGG + Intronic
1117225423 14:53653634-53653656 GATCAGAAAGGATCAGGATCAGG + Intergenic
1117510605 14:56447546-56447568 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1117531929 14:56667811-56667833 GGTCTGAAAAGCGCAGTATTCGG - Intronic
1118108427 14:62688208-62688230 GGTGGGAAAGGACTGGGATTTGG + Intergenic
1119414488 14:74460424-74460446 GCTCTGAAATGACCAGGTTCAGG - Intergenic
1120618623 14:86736323-86736345 GGTATTAAAGGACTAGGAATTGG - Intergenic
1122488290 14:102096043-102096065 GGTCTGAGAGCACCAAGATCAGG - Intronic
1202829716 14_GL000009v2_random:14188-14210 GGCCTCAAATGACCAGGAGTAGG - Intergenic
1125212830 15:37236933-37236955 GGTATTAAAGGACTAGGAATTGG + Intergenic
1125475834 15:40047557-40047579 GGTCTGAAAGGGGCTGGAGTGGG - Intergenic
1126112983 15:45186618-45186640 GGTCTGCAGGCACCAGGATAGGG - Intronic
1127348471 15:58126014-58126036 GGTCTGAAAAGCGCAGTATTCGG - Intronic
1128942525 15:71800262-71800284 AGTATGAAAGCACCGGGATTAGG - Intronic
1129256697 15:74337867-74337889 GGGCAGAAAGGAGCAGGACTTGG + Exonic
1129814153 15:78537383-78537405 TGTTTGAAAGGACCAGGACCTGG - Intergenic
1129854652 15:78814660-78814682 GGTCTGAAAGGACAAGTCTCAGG - Intronic
1130783362 15:87069082-87069104 GGGGTGAGAGGACCAGGATTGGG + Intergenic
1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG + Intergenic
1131225992 15:90624741-90624763 GGTCTGAGAGGACCTTGTTTTGG - Intronic
1134868932 16:17634072-17634094 GATCTTAAAGGACCAGGATGGGG + Intergenic
1135036563 16:19083194-19083216 TGGCTGGAAGGTCCAGGATTGGG + Intergenic
1139483306 16:67242589-67242611 CGTCAGCAAGGACCAGGGTTTGG - Intronic
1139596302 16:67960229-67960251 GGCCTGAAGGGACAAGGATGAGG + Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140965197 16:79959173-79959195 GGACCTAAGGGACCAGGATTGGG - Intergenic
1141294712 16:82756902-82756924 GCTCTGTGAGGGCCAGGATTTGG + Intronic
1143262033 17:5606698-5606720 GGTGTGAAGGAAACAGGATTTGG + Intronic
1143372060 17:6446613-6446635 GGTGTGAAAGGCCCAAGAGTTGG + Intronic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1146728026 17:35171302-35171324 GGTCTGGAAGGCACAGGGTTGGG - Exonic
1146932092 17:36784712-36784734 GGTATGAAAGAAGCAGAATTAGG + Intergenic
1148556848 17:48583644-48583666 GGGCTAGAAGGACCAGGATGGGG - Intronic
1150460619 17:65347301-65347323 GATCTGACAGAGCCAGGATTAGG - Intergenic
1150923294 17:69505874-69505896 AATCTGAAAGCACAAGGATTTGG - Intronic
1151080720 17:71325428-71325450 GGTCTGATAGGTTCAGGATGGGG - Intergenic
1151361925 17:73594104-73594126 GGCCTGACATGACCAGGTTTGGG - Intronic
1151979818 17:77502188-77502210 GGTCTGAATGGATGAGAATTTGG + Intergenic
1152126275 17:78449295-78449317 GGTTTGAAATCACCAGGTTTGGG + Intronic
1152658408 17:81530570-81530592 GGTCTGGAAGGACCTGAGTTGGG - Intronic
1153043583 18:836158-836180 GGTTTGAAAGGACGAGGACTAGG + Intergenic
1153726981 18:7966726-7966748 GGTCTGAAAAGCGCAGTATTCGG - Intronic
1153735549 18:8063179-8063201 GGTCTGAAAAGCGCAGTATTCGG + Intronic
1154418422 18:14200168-14200190 GGCCTCAAATGACCAGGAGTAGG - Intergenic
1156640963 18:39098194-39098216 GGGCTGAAAGGAACTAGATTAGG - Intergenic
1159643254 18:70888072-70888094 GGTATGAAAGCACCTGGAGTAGG + Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1164793081 19:31004446-31004468 AGTCTGAAATGACCAGCATTTGG - Intergenic
1165291220 19:34887792-34887814 TGTCTGAAAGGAACAGGCTGAGG + Intergenic
1165687879 19:37837785-37837807 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1166275820 19:41753142-41753164 GGAGTGACAGAACCAGGATTTGG - Intronic
1166754420 19:45181465-45181487 GCGCTGAAAGCACCAGGACTGGG - Exonic
1167599962 19:50449046-50449068 GGTTTAAAAGGATGAGGATTGGG + Intronic
1202642976 1_KI270706v1_random:113597-113619 GGCCTCAAATGACCAGGAGTAGG + Intergenic
1202706733 1_KI270713v1_random:29932-29954 AGTCTGACTGTACCAGGATTCGG - Intergenic
927897292 2:26791778-26791800 TGTTTGGAAGGATCAGGATTCGG + Intronic
928095528 2:28402551-28402573 GGTCTGATTGGACCAGCATAGGG + Intronic
928159002 2:28904226-28904248 GGTGGAAAAGGACCAGGCTTTGG + Intronic
929004440 2:37381721-37381743 GGTATTAAAGGACTAGGAATCGG + Intergenic
929422480 2:41807246-41807268 GGTCAGCAGGGACCAGGGTTAGG - Intergenic
929430168 2:41879801-41879823 GGTCTGAAAGGAGCAGCTCTTGG - Intergenic
929649730 2:43666195-43666217 GGTCTGAAAAGCGCAGTATTCGG + Intronic
931528962 2:63190913-63190935 GGTCTGAAAGATCCTGAATTGGG + Intronic
933203820 2:79482249-79482271 GGTCTCAAAGGATTAGGAGTTGG + Intronic
934498845 2:94837074-94837096 GGCCTCAAATGACCAGGAGTAGG + Intergenic
937942402 2:127296245-127296267 GGACTGAAAGGGACAGGCTTGGG + Intergenic
938262053 2:129903336-129903358 GGAGTGAGAGGCCCAGGATTCGG - Intergenic
939180946 2:138802143-138802165 CGTATGATAGGACCAGGATTTGG + Intergenic
939701325 2:145395804-145395826 GTTCTGAAAGGATTAGAATTAGG - Intergenic
940217319 2:151314502-151314524 GGTATGAAAGGACTAAGAATTGG - Intergenic
940835991 2:158522901-158522923 GGTCTGAAAAGGGCAGTATTCGG - Intronic
945492165 2:210468934-210468956 GGTTAGATAGGATCAGGATTTGG - Intronic
946479546 2:220040855-220040877 GCTGTGGCAGGACCAGGATTTGG - Intergenic
1170203547 20:13771109-13771131 TGTCTGAAAGGACAAAGATGTGG + Intronic
1171391204 20:24802748-24802770 GGTCTTAGAGGACCAGGGCTGGG - Intergenic
1172554178 20:35826434-35826456 AGTCTGAAATAACCAGGGTTGGG + Intronic
1173743205 20:45416861-45416883 GGTCTGAAAGTTTTAGGATTGGG - Intronic
1174037860 20:47679120-47679142 GTTCAGGAAGGGCCAGGATTTGG - Intronic
1175613444 20:60371760-60371782 GACCAGAAAGAACCAGGATTTGG - Intergenic
1176608901 21:8859028-8859050 GGCCTCAAATGACCAGGAGTAGG - Intergenic
1176854878 21:13959122-13959144 GGCCTCAAATGACCAGGAGTAGG + Intergenic
1176941122 21:14927366-14927388 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1178719735 21:34997932-34997954 GGGGTGGAAGGACCAGGACTGGG + Intronic
1180083643 21:45497821-45497843 GGCCTCATAGGACCTGGATTTGG + Intronic
1180358990 22:11868860-11868882 GGTCTCAAATGACCAGGAGTAGG - Intergenic
1180611114 22:17098626-17098648 GAACTGAAAGGAACAGGATGTGG + Intronic
1182448987 22:30407180-30407202 GGTCTGAAAGGCCTAGCATAGGG - Intronic
1183566692 22:38620441-38620463 AGTCTAACAGGACCAGGGTTAGG - Intronic
1184133003 22:42528976-42528998 GGCCTGAAAGCACCAGGACTAGG - Intergenic
1184212512 22:43044167-43044189 GGTTGGGAGGGACCAGGATTGGG - Intronic
949650555 3:6154145-6154167 TGTATAATAGGACCAGGATTTGG - Intergenic
951126057 3:18984931-18984953 GGTTTGAAAGAACCAAAATTGGG + Intergenic
951805412 3:26638469-26638491 GGTCTGACAGGTCCATGATGAGG - Intronic
952605907 3:35146338-35146360 GGTCTGAAAGGCCCAAGTCTTGG - Intergenic
953383876 3:42493738-42493760 GCTCTGCAAGGATCAGGATATGG + Intronic
954588325 3:51756588-51756610 GGTATTAAAGGACTAAGATTTGG + Intergenic
955333077 3:58063427-58063449 GGGCTGAAAGGTCCAGATTTGGG + Intronic
956927182 3:74002177-74002199 TAGCTGAAAGGACCAGGGTTAGG + Intergenic
959489866 3:106975728-106975750 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
959662023 3:108879585-108879607 TCTCTAAAAGGACCAGGATAGGG + Intergenic
961866257 3:129955547-129955569 GTTCTGAAATGACCAAGACTAGG + Intergenic
963906935 3:150780377-150780399 GGTTTGCAAGAACCAGGATGGGG - Intergenic
964299768 3:155275148-155275170 GGTTTGAAAGGACTAAGAATTGG + Intergenic
964613141 3:158634795-158634817 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
965624451 3:170672895-170672917 GGTATTAAAGGACCAAGAATTGG + Intronic
968261098 3:197324777-197324799 AGTCAGAAGGGGCCAGGATTGGG + Intergenic
971180846 4:24327494-24327516 GGTATAAAAGGACCAAGAATTGG - Intergenic
971240583 4:24885150-24885172 GGTCAGAAAGGGCCCGGATGTGG + Intronic
973589936 4:52430921-52430943 GGCCTGGAAGGAGCAGGGTTCGG - Intergenic
973817382 4:54631576-54631598 GGTGTGAAAGAAGCAGGACTTGG + Intergenic
974659298 4:64864867-64864889 GGTCTGAAAAGCCCAATATTCGG + Intergenic
974690697 4:65293959-65293981 GGTCTGAAAAGCCCAATATTCGG + Intergenic
974709338 4:65569825-65569847 GGTATGCAAAAACCAGGATTGGG - Intronic
977243579 4:94603310-94603332 GGGCTGGAAGGGGCAGGATTTGG + Intronic
977782041 4:100992398-100992420 GGTCTTAAAGGACTAAGAATTGG + Intergenic
978632536 4:110763328-110763350 GGTCGGAAAAGCCCAGTATTAGG + Intergenic
980298038 4:130947896-130947918 GGTATTAAAGGACCAAGAATTGG - Intergenic
980389308 4:132123151-132123173 GGTATTAAAGGACTAAGATTTGG - Intergenic
981567411 4:146115469-146115491 GGGCTGGAAGGTTCAGGATTAGG - Intergenic
983156111 4:164351033-164351055 GGTCTGAAAAGCGCAGTATTCGG - Intronic
983173251 4:164559218-164559240 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
983349545 4:166570259-166570281 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
984043799 4:174772010-174772032 GTTCTGAAAGGAGCAGTGTTAGG + Intronic
1202770345 4_GL000008v2_random:199492-199514 GGCCTCAAATGACCAGGAGTAGG + Intergenic
985574068 5:665613-665635 GGTCTGAAGGGGCATGGATTGGG - Intronic
985769426 5:1799626-1799648 GGTCTCAGAGGGCCAGGGTTGGG - Intronic
987531437 5:19126173-19126195 GGCCTGAAATGCCCAGGATGTGG - Intergenic
988872222 5:35403319-35403341 TTTCTGAAAGAACCAGTATTTGG + Intergenic
994969691 5:106719583-106719605 GGTCGGAAAGGCGCAGTATTTGG + Intergenic
998462127 5:142317543-142317565 TGTCTCTCAGGACCAGGATTGGG + Intronic
998693307 5:144612066-144612088 GGTTTTAAAGGACTAGGAATTGG + Intergenic
1000273045 5:159705124-159705146 GGTCTGGAAGGTCCTGCATTTGG - Intergenic
1000351014 5:160352825-160352847 GGTAGGAAAAGACCTGGATTTGG + Intronic
1002432357 5:179210939-179210961 GGTCTGCAAGGGCCAGCATGTGG - Intronic
1006170619 6:32089887-32089909 GTTCTGACAGGACCAAGCTTAGG - Intronic
1007108954 6:39301960-39301982 GGTGTGAAGGGCCCAGGCTTGGG + Intronic
1007120910 6:39380394-39380416 GTTTTAAAAGGACCAGGGTTCGG + Intronic
1008096288 6:47342873-47342895 AGACTGAAAGGAGCAGGAATAGG + Intergenic
1008849742 6:56010898-56010920 GGTATGAAAGGACTAAGAATTGG + Intergenic
1011367489 6:86598952-86598974 GGTCTTAAAGGACTAAGAATTGG + Intergenic
1011387336 6:86812379-86812401 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1011395105 6:86897989-86898011 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1014365896 6:120541377-120541399 TGTCTGAAAGGGAGAGGATTAGG - Intergenic
1015883655 6:137894349-137894371 GGTATGAAAGCAAAAGGATTTGG + Intergenic
1015966418 6:138698898-138698920 GGAGTGAGAGGATCAGGATTGGG - Intergenic
1016527598 6:145019959-145019981 GGTCAGAAAAGACCTGAATTGGG - Intergenic
1018354242 6:162995462-162995484 GGTCTGAAAAGCGCAGTATTCGG + Intronic
1021661044 7:22918209-22918231 GGTATTAAAGGACTAAGATTGGG - Intergenic
1021933199 7:25603304-25603326 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1027424196 7:78046085-78046107 GGCCTAAAAGGACCAGAAATAGG + Intronic
1028549062 7:92036900-92036922 GCTCAGAAAGAACCAGGGTTTGG - Intronic
1029936690 7:104432480-104432502 GGTGAGAAAGGAGCAGGACTTGG - Intronic
1031830719 7:126622128-126622150 TGTCTGACAAGACCAGGACTAGG + Intronic
1034697801 7:153069481-153069503 GTTGTGAAGGGAACAGGATTTGG + Intergenic
1034860610 7:154591892-154591914 AGTCTGAAGGGAGCAGGATGAGG + Intronic
1035281458 7:157781011-157781033 GGTGTGAGTGGACCAGGATGTGG - Intronic
1038360165 8:26867055-26867077 GGTGCAAAAGGACAAGGATTTGG - Intronic
1039028334 8:33282550-33282572 TGGCTGAAAGGTTCAGGATTGGG + Intergenic
1040294530 8:46142371-46142393 GGTTGGAAAGCACCAGGCTTTGG - Intergenic
1040947316 8:52897211-52897233 TGTCTGGAAAGACCAAGATTGGG + Intergenic
1041408575 8:57528435-57528457 GTTCTGAAGGAACCAAGATTAGG - Intergenic
1044936243 8:97295883-97295905 GGTCTGAAAAGGTCAGTATTCGG - Intergenic
1045079917 8:98614729-98614751 GGTCTGAAAAGCGCAGTATTCGG - Intronic
1045189900 8:99872058-99872080 GTTCAGGAAGGGCCAGGATTGGG + Intronic
1051203889 9:14664279-14664301 GGTCTGAAAAGCGCAGTATTAGG - Intronic
1051335936 9:16066029-16066051 GGACGGAAAGGACCTAGATTGGG - Intergenic
1052239891 9:26259040-26259062 GGTATGAAATGACCAGATTTGGG - Intergenic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1053658314 9:40243481-40243503 GGCCTCAAATGACCAGGACTAGG - Intronic
1053908686 9:42872755-42872777 GGCCTCAAATGACCAGGAGTAGG - Intergenic
1054370438 9:64389756-64389778 GGCCTCAAATGACCAGGACTAGG - Intronic
1054526284 9:66132740-66132762 GGCCTCAAATGACCAGGACTAGG + Intronic
1054678065 9:67879511-67879533 GGCCTCAAATGACCAGGACTAGG - Intronic
1054886513 9:70204777-70204799 GGTCTGAAAAGAGCAATATTCGG + Intronic
1056467755 9:86875122-86875144 GGTCTGAAAGGAGAAGACTTGGG - Intergenic
1058612809 9:106793524-106793546 GGTATTAAAGGACCAAGAATTGG - Intergenic
1059009099 9:110437327-110437349 GGCCTGAAATGACAAGGGTTAGG - Intronic
1059568630 9:115409884-115409906 GGTCTTCAAGGACAAGCATTTGG - Intergenic
1059752062 9:117257232-117257254 GGTCTAAAAGGACTAGAGTTTGG + Intronic
1060012433 9:120055520-120055542 GGTCTGAAAAGCGCAGTATTCGG - Intergenic
1061079701 9:128362450-128362472 GGTTTCCAAGGACCTGGATTTGG + Intergenic
1203704300 Un_KI270742v1:24253-24275 GGCCTCAAATGACCAGGAGTAGG - Intergenic
1185658823 X:1709484-1709506 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1188772052 X:34164195-34164217 AGTCTGAAAAGTCAAGGATTTGG + Intergenic
1195069062 X:101262265-101262287 GGTCTCAAGGGAACAAGATTTGG - Exonic
1196117864 X:112016566-112016588 GGTCTTAAAGTACTAGGATGTGG - Intronic
1196792372 X:119475782-119475804 CCAGTGAAAGGACCAGGATTAGG + Intergenic
1197417353 X:126190945-126190967 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1197491499 X:127122424-127122446 GGTCTGAAAAGCGCAGTATTCGG + Intergenic
1197793677 X:130279484-130279506 GGTATTAAAGGACTAGGAATTGG - Intergenic
1201397523 Y:13564990-13565012 GGTCTGAAAAGAACAATATTCGG + Intergenic