ID: 1053010260

View in Genome Browser
Species Human (GRCh38)
Location 9:34628900-34628922
Sequence AGGCAGGTGAGTGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053010260_1053010270 9 Left 1053010260 9:34628900-34628922 CCCGCGGCCGCACTCACCTGCCT No data
Right 1053010270 9:34628932-34628954 CGCTGCCCCTGGCGTCTCCACGG No data
1053010260_1053010267 -2 Left 1053010260 9:34628900-34628922 CCCGCGGCCGCACTCACCTGCCT No data
Right 1053010267 9:34628921-34628943 CTGGCGTGGCCCGCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053010260 Original CRISPR AGGCAGGTGAGTGCGGCCGC GGG (reversed) Intergenic
No off target data available for this crispr