ID: 1053014482

View in Genome Browser
Species Human (GRCh38)
Location 9:34654202-34654224
Sequence AAGGGGGAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3889
Summary {0: 1, 1: 3, 2: 39, 3: 505, 4: 3341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053014482 Original CRISPR AAGGGGGAGCAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr