ID: 1053015314

View in Genome Browser
Species Human (GRCh38)
Location 9:34658572-34658594
Sequence TCCAGCTGGCTCGCAGGCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053015314_1053015317 -6 Left 1053015314 9:34658572-34658594 CCGACGCCTGCGAGCCAGCTGGA 0: 1
1: 0
2: 0
3: 22
4: 78
Right 1053015317 9:34658589-34658611 GCTGGACATACCCTGCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053015314 Original CRISPR TCCAGCTGGCTCGCAGGCGT CGG (reversed) Exonic
903353519 1:22732266-22732288 GCCAACTGGCTCCCAGGAGTGGG + Intronic
903870677 1:26432214-26432236 TCCCACTAGCTCGCAGGCGCAGG + Intergenic
903928750 1:26850167-26850189 ACCAGCTGGCTCCCAGGCCTTGG - Intronic
905390589 1:37633626-37633648 CCCAGCAGGCTGGCAGGCGGGGG + Intronic
906757236 1:48330165-48330187 TCCAGCTGGCTACCAGTGGTGGG - Intronic
908500159 1:64734903-64734925 TCCAGCTGGCTTCCTGGCCTTGG - Intergenic
912625893 1:111204317-111204339 TCAGGCTGGCTCGAAGGCGGCGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1066306637 10:34150656-34150678 TCCAGCTGGGCCTCAGGCTTGGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069748084 10:70728687-70728709 CCCAGCTGACTGGCAGGCATAGG - Intronic
1076340101 10:129739685-129739707 TGCAGGTGGCTCGCAGGCTGAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088481084 11:110296746-110296768 TCCCGCAGGCTCGCAGCCGCAGG + Intergenic
1088896265 11:114080899-114080921 TCCACCTGCTTTGCAGGCGTGGG + Intronic
1089627714 11:119762201-119762223 CCCAGCTGACTCACAGGCCTGGG + Intergenic
1091316118 11:134615218-134615240 TCCAGCTGGCTCACCGCCGTGGG + Intergenic
1092057883 12:5522541-5522563 TGCAGCTGGCTCGCAGAGGTGGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1095980643 12:47972598-47972620 TCCTGCTGGATCGGAGACGTGGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101973778 12:109337062-109337084 TCCAGCTGGAACACAGTCGTTGG + Intergenic
1102492800 12:113298998-113299020 TCCAGCTGCCAGGCAGGAGTCGG - Exonic
1103339760 12:120215203-120215225 TCCAGCTGGCTCCCGGGCTTCGG + Exonic
1103984339 12:124757366-124757388 TCCAGCTGGCTAGCCTGGGTAGG - Intergenic
1104728750 12:131093760-131093782 TCCAGCTGGCTGGGAGGCAGAGG - Intronic
1108407626 13:50121615-50121637 TCCATCTGGCTCTCAGTCTTAGG + Intronic
1112139320 13:96620980-96621002 TCCAGCTGCCTCCCAGGTCTAGG - Intronic
1113970506 13:114185251-114185273 TCCAGGGGGCTCCCAGGGGTGGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118404750 14:65412489-65412511 TCCGGCTCGCACACAGGCGTAGG - Intronic
1118599226 14:67459803-67459825 CCCAGCTGGCTGGCAGCCCTGGG - Intronic
1120714267 14:87823309-87823331 TGCAGCTGGATCGTAGGCTTGGG - Intergenic
1124210597 15:27761938-27761960 TCCAGCTGGCTGGGAGGCTAAGG - Intronic
1141828092 16:86494889-86494911 TCGCGCTGGCTCACAGGGGTGGG - Intergenic
1142672987 17:1495973-1495995 ACCGGCTGGCTCCCAGGCCTGGG + Intronic
1143881515 17:10033727-10033749 GCCAGCTGGATCGCAGGTGCAGG - Intronic
1146359003 17:32159266-32159288 TCCAGGGGGCTCCCAGGTGTGGG - Intronic
1149563819 17:57627939-57627961 TCCAGGTAGCTGGCAGGCCTGGG + Intronic
1150827849 17:68492401-68492423 GACGGCTGGCTCGCAGGGGTGGG - Intergenic
1151361933 17:73594129-73594151 ACCTGCTGGCTCCCAGACGTTGG - Intronic
1153139552 18:1955222-1955244 TCCAGGGGGCTCCCAGGAGTGGG + Intergenic
1153597761 18:6745854-6745876 TCCAGCTGTCTGGCAGCTGTTGG + Intronic
1154028987 18:10733773-10733795 TCCAGCTGGCTGACAGGTGCAGG - Intronic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1160983359 19:1826773-1826795 TCCAGTTGGCTCGGAGGCACGGG - Intronic
1161714014 19:5865479-5865501 TTCAGCTGGCTCCCTGGGGTGGG - Intergenic
925412136 2:3645885-3645907 TGGAGCTGGCTCCCAGGGGTGGG + Intergenic
926524230 2:13956693-13956715 TCCAGCAGGTTCGCAGGTGAAGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
935793746 2:106619002-106619024 TTCAGCAGGCTCTCAGGTGTAGG + Intergenic
939848032 2:147271170-147271192 TGCAGGTGGCTTGCAGGCTTGGG - Intergenic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948055870 2:235008947-235008969 TCCAGCTGGCTTACAGGGGCTGG + Intronic
1173223270 20:41146413-41146435 GCCAGCTGGCACACAGGTGTTGG + Intronic
1173256362 20:41396486-41396508 TCCAGCTGGCTCTCAGAAGCAGG - Intergenic
1175859830 20:62144048-62144070 GCCCGCCGGCGCGCAGGCGTGGG - Intronic
1179190769 21:39119951-39119973 TCCTGCTGCCTGGCTGGCGTGGG - Intergenic
1180843086 22:18968294-18968316 TCCAGCTAGCACCCAGGAGTGGG + Intergenic
1183929586 22:41228336-41228358 TCCACCTGGCTCTCAGGCCGTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950294877 3:11820860-11820882 TACAGGTGGCTTGCAGGCCTTGG - Intronic
951724554 3:25742790-25742812 TTCAGCTGGCTCCCCGTCGTAGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
956345274 3:68271276-68271298 TCCAGCTGGGAAGCAGGAGTTGG - Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
959131650 3:102363563-102363585 TCCTGCTGCCTTGCAGGCCTAGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961203860 3:125065700-125065722 TCCAGGTGGCTCGCATTAGTTGG + Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
969676199 4:8615677-8615699 TCTGGCTGGCTCGCAGACATTGG - Intronic
971757336 4:30720930-30720952 ACCAGCGGGCTGGCAGGCGGGGG + Exonic
973005029 4:44995332-44995354 TCCAGCTAGCAGGGAGGCGTTGG - Intergenic
975044684 4:69787002-69787024 TTCAGCTGGCTCTCAGCCCTGGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1001299776 5:170525140-170525162 GACAGCTGGCTCCCAGGCGTGGG - Intronic
1005189256 6:23201155-23201177 TCCAGCTGACTCTCATCCGTGGG - Intergenic
1006522719 6:34581319-34581341 TCCAGCTGGCTCCCATCCCTAGG - Intergenic
1015149037 6:130019109-130019131 TCAGGCTGGCGCGCAGGCGGCGG + Intronic
1018729204 6:166636241-166636263 TCCAGCTCGCTCTCAAGCTTTGG + Intronic
1025776885 7:64568469-64568491 TGCAGCTGGCCCACAGGTGTGGG - Intergenic
1029110172 7:98210083-98210105 TCACGCTGGCTGGCAGGCCTGGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035224820 7:157427214-157427236 TCCCTGTGGCTCGCAGGCGCTGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1049151867 8:141040332-141040354 GCCAGCTGGATGGCAGGAGTCGG - Intergenic
1051917799 9:22229263-22229285 TCCAGCTGGCCAGCAGCAGTAGG + Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1186298673 X:8175976-8175998 TCCAACTGGTTCGCAGGTGTAGG + Intergenic
1186410215 X:9340261-9340283 TCCAGCTGGCTCTCAGGCTATGG + Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1199508446 X:148592726-148592748 TCAAGCTAGCTCACAGGAGTAGG - Intronic
1201439370 Y:13991862-13991884 TCCAACTGGTTCACAGGTGTAGG + Intergenic
1201445203 Y:14050846-14050868 TCCAACTGGTTCACAGGTGTAGG - Intergenic