ID: 1053019224

View in Genome Browser
Species Human (GRCh38)
Location 9:34683459-34683481
Sequence ACAAGTGGAGGGCTGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053019224_1053019235 21 Left 1053019224 9:34683459-34683481 CCCATCACCAGCCCTCCACTTGT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019224_1053019236 22 Left 1053019224 9:34683459-34683481 CCCATCACCAGCCCTCCACTTGT No data
Right 1053019236 9:34683504-34683526 GTTCTATCCTGCACCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053019224 Original CRISPR ACAAGTGGAGGGCTGGTGAT GGG (reversed) Intergenic
No off target data available for this crispr