ID: 1053019225

View in Genome Browser
Species Human (GRCh38)
Location 9:34683460-34683482
Sequence GACAAGTGGAGGGCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053019225_1053019235 20 Left 1053019225 9:34683460-34683482 CCATCACCAGCCCTCCACTTGTC No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019225_1053019236 21 Left 1053019225 9:34683460-34683482 CCATCACCAGCCCTCCACTTGTC No data
Right 1053019236 9:34683504-34683526 GTTCTATCCTGCACCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053019225 Original CRISPR GACAAGTGGAGGGCTGGTGA TGG (reversed) Intergenic
No off target data available for this crispr