ID: 1053019227

View in Genome Browser
Species Human (GRCh38)
Location 9:34683470-34683492
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053019227_1053019239 25 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019227_1053019235 10 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019227_1053019240 26 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019240 9:34683519-34683541 ATGAAGGGTCTCACGTGTCTGGG No data
1053019227_1053019236 11 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019236 9:34683504-34683526 GTTCTATCCTGCACCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053019227 Original CRISPR AGAGGAGAGGGACAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr